TkA05G116330 | RubberDandelionOmics

Gene overview

TkA05G116330

Reference: TK1151 Chr: Chr05 Coordinates: 31034887-31036451 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

702 bp · TkA05G116330|TK1151|cDNA

ATGAGAAAGAAGATTATACCAGAAGATGCTTCATTTGTTACATTAATCACCATCCTAAGATTCACAATTGAAGTCGGGTTATCAAAGCATGAAGTCGAGTCCCAGTTCCAGAGTTTAAGGTACGTTGCTGACGTGGCGCCATTACTACCTTTAATCATATTAGCCTACCTACTTCACAAAATCATGGCTTGCAAGTCGTGTAACCGTCTTCTAAAACTTGTCATATCCGGGAGCATATTCAGTTACATTCTAGTTGCATT...

CDS

Download CDS FASTA

702 bp · TkA05G116330|TK1151|CDS

ATGAGAAAGAAGATTATACCAGAAGATGCTTCATTTGTTACATTAATCACCATCCTAAGATTCACAATTGAAGTCGGGTTATCAAAGCATGAAGTCGAGTCCCAGTTCCAGAGTTTAAGGTACGTTGCTGACGTGGCGCCATTACTACCTTTAATCATATTAGCCTACCTACTTCACAAAATCATGGCTTGCAAGTCGTGTAACCGTCTTCTAAAACTTGTCATATCCGGGAGCATATTCAGTTACATTCTAGTTGCATT...

Protein

Download Protein FASTA

233 aa · TkA05G116330|TK1151|PROTEIN

MRKKIIPEDASFVTLITILRFTIEVGLSKHEVESQFQSLRYVADVAPLLPLIILAYLLHKIMACKSCNRLLKLVISGSIFSYILVALFDVNLSPIFDGIKGNFISRVVYVVGIAQLLALAVYRLLESSSKWGERRMVKGVAMVSTWSSTLMILSGKQGPWIALALVLGGWMIWRLKDLQQQDDDKKAGTIGLLASSITQWSLFCIVSILCYWSLVRNYIYLKFTVNTIIIIFY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G116330`
TK1151 ID	TkA05G116330
OH-1004 ID	LXL04_020002
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	87.700
Protein coverage (%)	TK1151 87.124 / OH-1004 20.417 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G116330`
Location	Chr05:31034887-31036451 (-)
Description	Similar to PIGO: GPI ethanolamine phosphate transferase 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020002` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006506 GPI anchor biosynthetic process Biological Process GO:0071555 cell wall organization Biological Process GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:0016772 transferase activity, transferring phosphorus-containing groups Molecular Function GO:0051377 mannose-ethanolamine phosphotransferase activity Molecular Function
KEGG gene cross-reference	hsa:84720 sce:YLL031C These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.350

Rank 1 · TkA05G116330 · TK1151

Plastid0.192

Rank 2 · TkA05G116330 · TK1151

Mitochondrion0.130

Rank 3 · TkA05G116330 · TK1151

Golgi apparatus0.126

Rank 4 · TkA05G116330 · TK1151

Nucleus0.104

Rank 5 · TkA05G116330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06197DUF99869-173 aa

PF04070DUF37871-120 aa

PF04070DUF378160-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G116330	`PF06197`	DUF998	69	173	0.013	15.9
TkA05G116330	`PF04070`	DUF378	71	120	0.0054	17.3
TkA05G116330	`PF04070`	DUF378	160	169	0.0054	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card