TkA05G115160 | RubberDandelionOmics

Gene overview

TkA05G115160

Reference: TK1151 Chr: Chr05 Coordinates: 30747195-30761613 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7796 bp · TkA05G115160|TK1151|cDNA

TTTACTCATTTCTTTATTTACATATAGAAAACCCCCGTCAAGAACTTCAACCACCACCGGGTATGCACTCCCTGCCCTAGCCTTGTCGTGTTCAGACTAAATTCCCGAATTCGGAAATCGGAGCTCTGTACGATTAGTTGCATTTTTCCTCAAAGAAGACTGCGATGTGAAATCAAATGAATTAAGAATAGAAGAACAACCGTATTAGTTGTGGGAGAGATGATTTTTGCAACTATACGTTCAAAACAAAGTGAGCAACC...

CDS

Download CDS FASTA

7320 bp · TkA05G115160|TK1151|CDS

ATGGCAGCAACTCCCCAAAATGTGGAGATGGAAGCAGCAAAATTCCTGCATAAGCTTATTCAGGAATCCACTGACGAGCCCACAAAGTTGGCTACCAAACTACATGTGATTTTGCAGCATATGAGATCCAGTGGAAAGGAGAATTCAATGCCGTACCAAGTTATATCAAGGGCTATGGAGACGGTTATAAATCGATATGGTCTTGACATTGAGGCTTTAATGTCACAAAGGCAACCTTTGACCAGTGGAAGTCAACCCGG...

Protein

Download Protein FASTA

2439 aa · TkA05G115160|TK1151|PROTEIN

MAATPQNVEMEAAKFLHKLIQESTDEPTKLATKLHVILQHMRSSGKENSMPYQVISRAMETVINRYGLDIEALMSQRQPLTSGSQPGDSSLSQIAGTSQQSAMENDSKKPLTTEDAMKIATFSSKPLHGPSTAALDMYQGSANQLNPMKSHGSNAGIPGSYESTEAMQQFNNSYDNQTAAMSMHKTLPIPGKALDHEGGFSNVMANASKTLQQGGISNNVAEMGMLRNEASRDTGKLPVVQASPAGPSMPFKEHHLKQLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G115160`
TK1151 ID	TkA05G115160
OH-1004 ID	LXL04_019996
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.200
Protein coverage (%)	TK1151 99.631 / OH-1004 99.468 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G115160

Location Chr05:30747195-30761613 (+)

Description Similar to SYD: Chromatin structure-remodeling complex protein SYD

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28290`	Catalytic component of the chromatin structure-remodeling complex (RSC), which is involved in transcription regulation and nucleosome positioning.	No verified direct reference in this release
`At3g06010`	Probable chromatin-remodeling factor that is functionally redundant with CHR23 in root and shoot stem cell initiation, and root apical meristem (RAM) and shoot apical meristem (SAM) maintenance.	The SWI/SNF chromatin-remodeling gene AtCHR12 mediates temporary growth arrest in Arabidopsis thaliana upon perceiving environmental stress.2007 · DOI: 10.1111/j.1365-313x.2007.03185.x Mutations in two non-canonical Arabidopsis SWI2/SNF2 chromatin remodeling ATPases cause embryogenesis and stem cell maintenance defects.2012 · DOI: 10.1111/tpj.12009 Reduced seed germination in Arabidopsis over-expressing SWI/SNF2 ATPase genes.2015 · DOI: 10.1111/ppl.12231

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0144300`	Probable chromatin-remodeling factor involved in root and shoot stem cell initiation, and root apical meristem (RAM) and shoot apical meristem (SAM) maintenance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019996 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006952 defense response Biological Process

GO:0007064 mitotic sister chromatid cohesion Biological Process

GO:0009408 response to heat Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0010078 maintenance of root meristem identity Biological Process

KEGG gene cross-reference

ath:AT2G28290

ath:AT3G06010

dosa:Os05g0144300

osa:4337784

spo:2538881

spo:2542638

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.926

Rank 1 · TkA05G115160 · TK1151

Cytoplasm0.137

Rank 2 · TkA05G115160 · TK1151

Cell membrane0.026

Rank 3 · TkA05G115160 · TK1151

Mitochondrion0.021

Rank 4 · TkA05G115160 · TK1151

Endoplasmic reticulum0.015

Rank 5 · TkA05G115160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14619SnAC538-564 aa

PF04851ResIII734-896 aa

PF00176SNF2-rel_dom738-1029 aa

PF00270DEAD755-902 aa

PF00271Helicase_C772-841 aa

PF06733DEAD_2807-876 aa

PF11496HDA2-3980-1185 aa

PF00271Helicase_C1055-1168 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G115160	`PF14619`	SnAC	538	564	1.1e-12	49.0
TkA05G115160	`PF04851`	ResIII	734	896	2.8e-14	54.1
TkA05G115160	`PF00176`	SNF2-rel_dom	738	1029	1.2e-91	307.5
TkA05G115160	`PF00270`	DEAD	755	902	2.8e-05	24.7
TkA05G115160	`PF00271`	Helicase_C	772	841	2.9e-22	79.7
TkA05G115160	`PF06733`	DEAD_2	807	876	0.00059	20.3
TkA05G115160	`PF11496`	HDA2-3	980	1185	3.7e-06	27.0
TkA05G115160	`PF00271`	Helicase_C	1055	1168	2.9e-22	79.7
TkA05G115160	`PF00271`	Helicase_C	1194	1223	2.9e-22	79.7
TkA05G115160	`PF14619`	SnAC	1273	1359	1.1e-12	49.0
TkA05G115160	`PF04851`	ResIII	2061	2087	2.8e-14	54.1
TkA05G115160	`PF14619`	SnAC	2332	2353	1.1e-12	49.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IHS2`	Arabidopsis thaliana	sp\|F4IHS2\|SYD_ARATH Chromatin structure-remodeling complex protein SYD	62.700%	Swiss-Prot	Medium
`F4J9M5`	Arabidopsis thaliana	sp\|F4J9M5\|CHR12_ARATH Probable ATP-dependent DNA helicase CHR12	47.100%	Swiss-Prot	Low
`Q60EX7`	Oryza sativa subsp. japonica	sp\|Q60EX7\|CHR19_ORYSJ Probable ATP-dependent DNA helicase CHR719	45.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card