TkA05G113270 | RubberDandelionOmics

Gene overview

TkA05G113270

Reference: TK1151 Chr: Chr05 Coordinates: 30261013-30263783 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2343 bp · TkA05G113270|TK1151|cDNA

GCCATTGTATTCAACTTTTACTTAAAATTAAGCTTCCTTTCTTTCACAGAAAAGTTATGTCTCCGACGCTATTAACCAATCAGAAATTGGTAGAAAAGCAATATGTCAAGTCCATAAACGCAAACAACAATATCAGCGATTGTATGCTGCTTATGGACAAACAATTACCCGAGAGTGATTCCACCATTGATGGTAAATTAAGGTGGTTACGCTCACAAATAATCGGTGGGATGGATGAGATTCAAACTCCATTTGGAAAA...

CDS

Download CDS FASTA

1140 bp · TkA05G113270|TK1151|CDS

ATGTCACCGGAATTTACACAGACACCCGTTCTCTATCTCGCTTGCTTCACAAGTATGGAGCTTTTTCATGCTTTGATTTTGCTGCAAGAGATTGACATGAGGTCAGGTGATGTTGATGGCTACGATGCCATAGCTTTAAGTCCACACAAGTTTCTTGGAGGACCTGGAACTCCTGGGATTCTTCTGATGAGCAAGGCACTGTACATGCTCAAAGATTCTCCTCCTTCGACATGTGGAGGTGGGACTGTTAACTTCGTCAA...

Protein

Download Protein FASTA

379 aa · TkA05G113270|TK1151|PROTEIN

MSPEFTQTPVLYLACFTSMELFHALILLQEIDMRSGDVDGYDAIALSPHKFLGGPGTPGILLMSKALYMLKDSPPSTCGGGTVNFVNCFNEKDTLYVSDIEEREDAGTPQIIQQVKTALAFRLKEYISCEVIAKKERKYIESALERLVKNPNIWVLGNTMADRQPILSFLVYTTTDTLDVAMGTRNNRGKPLNGGFVAKLINDLFGIQARGGCACAGPYAHCLLGIDEPHSLTIKSAVEMGYNGARLGWTRVSFPYYMSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G113270`
TK1151 ID	TkA05G113270
OH-1004 ID	LXL04_015639
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 92.348 / OH-1004 56.543 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G113270`
Location	Chr05:30261013-30263783 (-)
Description	Similar to csd: Probable cysteine desulfurase (Staphylococcus aureus (strain N315)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015639` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006534 cysteine metabolic process Biological Process GO:0030170 pyridoxal phosphate binding Molecular Function GO:0031071 cysteine desulfurase activity Molecular Function
KEGG gene cross-reference	sam:MW0797 sar:SAR0878 sas:SAS0786 sau:SA0776 sav:SAV0844 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.539

Rank 1 · TkA05G113270 · TK1151

Nucleus0.291

Rank 2 · TkA05G113270 · TK1151

Mitochondrion0.138

Rank 3 · TkA05G113270 · TK1151

Peroxisome0.084

Rank 4 · TkA05G113270 · TK1151

Endoplasmic reticulum0.084

Rank 5 · TkA05G113270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00266Aminotran_531-260 aa

PF29376PRP6_TPR242-346 aa

PF17034zinc_ribbon_16295-322 aa

PF16674UCH_N295-351 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G113270	`PF00266`	Aminotran_5	31	260	1.2e-14	54.8
TkA05G113270	`PF29376`	PRP6_TPR	242	346	0.11	11.8
TkA05G113270	`PF17034`	zinc_ribbon_16	295	322	0.087	13.8
TkA05G113270	`PF16674`	UCH_N	295	351	0.31	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card