TkA05G105070 | RubberDandelionOmics

Gene overview

TkA05G105070

Reference: TK1151 Chr: Chr05 Coordinates: 28119399-28121654 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1955 bp · TkA05G105070|TK1151|cDNA

GAAAAAGAGAAAGTAGGGGTCTTGACTTAATTAATTTCAATTCTTATCCAAGCTCTTATCCCGACATATTCTTGGGTTTTACTTTTATGTGAATTCACATTTTCACCAAACAAAACAAAAGAAAAATCAAAATCTTCATCTTCAATCATCAAAACCCCGTATAAAAAACGTTCTTTATCTTAAGCACCACACCAACATACATCAGGAACCTTCCTCTCTTCCCCTTCTTGCCTGCAATCGAAGAAACTCGCCCTTTATTA...

CDS

Download CDS FASTA

1338 bp · TkA05G105070|TK1151|CDS

ATGGCTTCTGGATCATCAAAAGGGTTTGATTTTGCATCCGACGATATTCTTTGTTCATACGAAGACTACGCAAATCAAGAAGGTTCTAACGGAAATCACTCAGAGTCTGCGATCGCCGCTAATTCCGCGAAAGAATTCCACAAAAACAGAATGGCAAGAACATCGGTGTTCCCTGGTTCATCGTACAATCCCCCAGATGATTCCGGTAACCAAGAAGTACTGATTTCAGCTGTGGAGAGGTCCATGAAGAAATATTCCGA...

Protein

Download Protein FASTA

445 aa · TkA05G105070|TK1151|PROTEIN

MASGSSKGFDFASDDILCSYEDYANQEGSNGNHSESAIAANSAKEFHKNRMARTSVFPGSSYNPPDDSGNQEVLISAVERSMKKYSDNLMRFLEGLSSRLSQLELYCYNLDKSIGEMRSDLTRDHGEADVKLKFLEKHLQEVHRSVQILRDKQELADTQKELAKLQMAHKESSSSHNSQQNEERCSTPDTKKTENSPDPHGQQLALVLPSQLAPPPPQPQRPPQPQGYYLPPAPTTQYLHPQPPQQPPQQQQPQYQPQWG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G105070`
TK1151 ID	TkA05G105070
OH-1004 ID	LXL04_019913
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G105070`
Location	Chr05:28119399-28121654 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019913` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.625

Rank 1 · TkA05G105070 · TK1151

Nucleus0.325

Rank 2 · TkA05G105070 · TK1151

Cell membrane0.099

Rank 3 · TkA05G105070 · TK1151

Golgi apparatus0.099

Rank 4 · TkA05G105070 · TK1151

Endoplasmic reticulum0.081

Rank 5 · TkA05G105070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02601Exonuc_VII_L72-186 aa

PF23831DUF720181-148 aa

PF01496V_ATPase_I85-192 aa

PF14276DUF4363102-174 aa

PF07223DUF1421395-438 aa

PF08587UBA_2397-433 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G105070	`PF02601`	Exonuc_VII_L	72	186	0.42	10.8
TkA05G105070	`PF23831`	DUF7201	81	148	0.24	11.8
TkA05G105070	`PF01496`	V_ATPase_I	85	192	0.34	9.5
TkA05G105070	`PF14276`	DUF4363	102	174	0.042	14.6
TkA05G105070	`PF07223`	DUF1421	395	438	1.6e-21	76.6
TkA05G105070	`PF08587`	UBA_2	397	433	0.29	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card