TkA05G075890 | RubberDandelionOmics

Gene overview

TkA05G075890

Reference: TK1151 Chr: Chr05 Coordinates: 20185096-20191099 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1457 bp · TkA05G075890|TK1151|cDNA

CCCTAATTACACATAAACTTAAAAGATGAGATTTAGGCCTTTTTAAGATTGGCTTGCCAGTCTTTTTGCCCTAACTTGCCTGCTCGCTATCAAATCTCGACGCTCCACCCTCTTCGCCATAACTGCTTCGATCTGTGAAATCGATCTGCCATTTGAAATCGCCATTAATCCCGTCTGTGAAATCGATTGCTCTTTGAAATCGCCATGTACATGCTTCCTTTAATCGGCATTTGTGATATCGATTTCATCTCCTTTAACAA...

CDS

Download CDS FASTA

834 bp · TkA05G075890|TK1151|CDS

ATGTCGATGTCGAAGGGTTCGAAGATGCTCCAGTTCATCAATTACCGTATGCGAATCACGATTCAAGACGGTCGCCAGCTAGTCGGCAAGTTCATGGCCTTCGACCGCCACATGAACCTTGTAATTGGAGATTGTGAAGAGTTTCGCAAGCTACCCCCTGCTAAAGGTGCGAAGAAGAACGAAGAACGCGAGGACCGACGGACTCTTGGTCTCGTTCTTCTGAGGGGAGAAGAGGTGATCTCCATGACCGTAGAAGGCCC...

Protein

Download Protein FASTA

277 aa · TkA05G075890|TK1151|PROTEIN

MSMSKGSKMLQFINYRMRITIQDGRQLVGKFMAFDRHMNLVIGDCEEFRKLPPAKGAKKNEEREDRRTLGLVLLRGEEVISMTVEGPPPPDENRAKAVGAAALAGPGLGRAAGRGIPTAPLIQAQPGLSGPVRGIGGPAPGMMQPQISRPPVPNMSAPPMNYPQAPVIRPGQMPYPGQGPPPQMPRGPPPQMPPQFGQRPPGQYPVPPPGQYGQRPMVPPPQMMRGPPPPGGAPRPGMPGPPPPARPGMPPPGGQMPGFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G075890`
TK1151 ID	TkA05G075890
OH-1004 ID	LXL04_022058
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 77.809 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G075890`
Location	Chr05:20185096-20191099 (+)
Description	Similar to SNRPN: Small nuclear ribonucleoprotein-associated protein N
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022058` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000395 mRNA 5'-splice site recognition Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0007281 germ cell development Biological Process GO:0036261 7-methylguanosine cap hypermethylation Biological Process GO:0045292 mRNA cis splicing, via spliceosome Biological Process GO:0071045 nuclear histone mRNA catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005681 spliceosomal complex Cellular Component GO:0005682 U5 snRNP Cellular Component GO:0005685 U1 snRNP Cellular Component GO:0005686 U2 snRNP Cellular Component GO:0005687 U4 snRNP Cellular Component
KEGG gene cross-reference	bta:780877 cel:CELE_W08E3.1 ddi:DDB_G0272320 dme:Dmel_CG5352 spo:2542684 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.926

Rank 1 · TkA05G075890 · TK1151

Cytoplasm0.264

Rank 2 · TkA05G075890 · TK1151

Cell membrane0.023

Rank 3 · TkA05G075890 · TK1151

Endoplasmic reticulum0.020

Rank 4 · TkA05G075890 · TK1151

Mitochondrion0.018

Rank 5 · TkA05G075890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01423LSM9-83 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G075890	`PF01423`	LSM	9	83	7.3e-16	58.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card