TkA05G063940 | RubberDandelionOmics

Gene overview

TkA05G063940

Reference: TK1151 Chr: Chr05 Coordinates: 17058799-17062777 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2336 bp · TkA05G063940|TK1151|cDNA

GAGGTCTGAATGGCTAATCGGTCTCTTATTCGGGTAGACATTTGAGGGGCGCTGAATGAAACTTTTACCTTGTTGCCCTTTACCCTGATGCCCATCGTAACATAACATCTGCGTATACCATCTTCTGCCGCATCCAAGTTCCACCCACAACGTCCCTCGAACTACCTCCGGTCAGCAACTCCACTCCGCCACCGCCGCCGCCGCTCCCCCCATTATCCGCCCTCCGCCAGCGACAGCACCCCTCCGCTAGCAAGTTTTCT...

CDS

Download CDS FASTA

1737 bp · TkA05G063940|TK1151|CDS

ATGTCGTCAATTCAATCTTCATCAAGGAAGCGAAAGAACAAAGGATCGGGAGACAACAGTAATAGGAAGAAGAAGCCCCAACAAGATCTTTCCGACGTTAGGAAACTGGGTGAACAGTTGCTCTCATCCAGAGCTCACATTAACAACCTTCCCCTCCTCCTTAATTTCCTCGACCCCAAATCCTCTTATCCTCGTGAATTCCTCCTTGAATCTCTTCTTTCTCTCCAATCCTTCTTCACCCCACTCCTCCCCCAACTCCC...

Protein

Download Protein FASTA

578 aa · TkA05G063940|TK1151|PROTEIN

MSSIQSSSRKRKNKGSGDNSNRKKKPQQDLSDVRKLGEQLLSSRAHINNLPLLLNFLDPKSSYPREFLLESLLSLQSFFTPLLPQLPSSSSKPTEDPESIYHTWVRSKFDEFVQCLIQLALSPTLSEEALREVVMDTLMECVKSGNAGNFHSSIYHKFIHSLVYSTHEADTLLSLLETKYFKYIDVRYFTYISLEKITRTLDVKECQDMEPESAETKDEIPGKASGQLLVRNIHHIISKIPPLEKLGENSEYEMWNGSGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G063940`
TK1151 ID	TkA05G063940
OH-1004 ID	LXL04_019570
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G063940

Location Chr05:17058799-17062777 (-)

Description Similar to NOC4: Protein NUCLEOLAR COMPLEX ASSOCIATED 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g17250`	Essential protein required during embryogenesis.	40S ribosome biogenesis co-factors are essential for gametophyte and embryo development.2013 · DOI: 10.1371/journal.pone.0054084

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019570 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006364 rRNA processing Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0030692 Noc4p-Nop14p complex Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0032040 small-subunit processome Cellular Component

KEGG gene cross-reference

ath:AT2G17250

mmu:100608

rno:360828

xla:414653

xla:431875

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.938

Rank 1 · TkA05G063940 · TK1151

Cytoplasm0.175

Rank 2 · TkA05G063940 · TK1151

Mitochondrion0.018

Rank 3 · TkA05G063940 · TK1151

Cell membrane0.013

Rank 4 · TkA05G063940 · TK1151

Golgi apparatus0.008

Rank 5 · TkA05G063940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26702TPR_NOC430-198 aa

PF28893Gem4_1st_TPR110-238 aa

PF06345Drf_DAD134-147 aa

PF03914CBF147-177 aa

PF03914CBF352-504 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G063940	`PF26702`	TPR_NOC4	30	198	1.5e-16	61.6
TkA05G063940	`PF28893`	Gem4_1st_TPR	110	238	0.03	14.2
TkA05G063940	`PF06345`	Drf_DAD	134	147	0.2	12.4
TkA05G063940	`PF03914`	CBF	147	177	1.1e-44	153.0
TkA05G063940	`PF03914`	CBF	352	504	1.1e-44	153.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IMH3`	Arabidopsis thaliana	sp\|F4IMH3\|NOC4_ARATH Protein NUCLEOLAR COMPLEX ASSOCIATED 4	58.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card