TkA05G060250 | RubberDandelionOmics

Gene overview

TkA05G060250

Reference: TK1151 Chr: Chr05 Coordinates: 15975446-15976763 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1237 bp · TkA05G060250|TK1151|cDNA

AATAGACAATGATGTCATACACACTTATTTACAACATGGTGTCATTCATACAATTATTTATAACAATAGTCATATTTTTCTTTTTTTTTTTCTGTTATTTTTAACGGCTGAAATTAAAGATGTTTGCATAAAATATTAGCCCAAGATAGAGACACGTCTTCGAAATAATTTCCCTCCTCCGGCAAAAGCTTTGTGGGGTTTCTCTTCTGGACAATCCTACCGTTAGCTCCACTTTTACCCTTTTTCACCTCTATTTTAGG...

CDS

Download CDS FASTA

735 bp · TkA05G060250|TK1151|CDS

ATGGGTTCGGAACAGAAGCAAAACGATGATCCATTAGGGGCGGATGTGGACACGTCGCCGCCGTTTACGTCGGTGATGGAGGCCGTCAGTCGATTTGGTGGCGTCGGCTTCTGGAGACCTGACGCCACTCAACCTTCCCAGACCAGCAGCGAACAAGTTCTCGACCATTTGCAGAACGATCCTGCAGCAGAAAGACGCGAAACCCTCGAAGCAACAAAAACTATATTCGAAGAAATTAAAGCTGGAGTGCAAAAATCCGA...

Protein

Download Protein FASTA

244 aa · TkA05G060250|TK1151|PROTEIN

MGSEQKQNDDPLGADVDTSPPFTSVMEAVSRFGGVGFWRPDATQPSQTSSEQVLDHLQNDPAAERRETLEATKTIFEEIKAGVQKSDEPNHDVRVEISENEILKRVKEATEDVKHCTRVLEEVLRRVEAAKNGTYLDSDAVVVSRPMMSIGQILSRKLFLAGERPEKSCLRWKVSWAEILWKGSDNGEKRGGDGGGGEKGVPAKRMKLGCGGGGDKGVPVKRMKLGFGSISFMVGKKKAWKQSR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G060250`
TK1151 ID	TkA05G060250
OH-1004 ID	LXL04_011958
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	33.100
Protein coverage (%)	TK1151 52.049 / OH-1004 27.083 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G060250

Location Chr05:15975446-15976763 (+)

Description Similar to At2g40480: WEB family protein At2g40480

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40480`	WEB family protein At2g40480.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011958 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009903 chloroplast avoidance movement Biological Process

GO:0009904 chloroplast accumulation movement Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G38370

ath:AT2G40480

ath:AT3G51720

ath:AT3G56270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.446

Rank 1 · TkA05G060250 · TK1151

Nucleus0.406

Rank 2 · TkA05G060250 · TK1151

Cell membrane0.306

Rank 3 · TkA05G060250 · TK1151

Endoplasmic reticulum0.075

Rank 4 · TkA05G060250 · TK1151

Mitochondrion0.038

Rank 5 · TkA05G060250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05701WEMBL15-72 aa

PF24740DUF769120-78 aa

PF14992TMCO565-139 aa

PF12186AcylCoA_dehyd_C66-85 aa

PF05701WEMBL71-132 aa

PF12186AcylCoA_dehyd_C96-140 aa

PF02609Exonuc_VII_S101-128 aa

PF24740DUF7691112-126 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G060250	`PF05701`	WEMBL	15	72	7.9e-07	28.9
TkA05G060250	`PF24740`	DUF7691	20	78	0.17	12.7
TkA05G060250	`PF14992`	TMCO5	65	139	0.022	14.7
TkA05G060250	`PF12186`	AcylCoA_dehyd_C	66	85	0.21	12.4
TkA05G060250	`PF05701`	WEMBL	71	132	7.9e-07	28.9
TkA05G060250	`PF12186`	AcylCoA_dehyd_C	96	140	0.21	12.4
TkA05G060250	`PF02609`	Exonuc_VII_S	101	128	0.22	12.2
TkA05G060250	`PF24740`	DUF7691	112	126	0.17	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XVC7`	Arabidopsis thaliana	sp\|Q5XVC7\|Y2048_ARATH WEB family protein At2g40480	37.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card