TkA05G041540 | RubberDandelionOmics

Gene overview

TkA05G041540

Reference: TK1151 Chr: Chr05 Coordinates: 11091840-11093170 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

983 bp · TkA05G041540|TK1151|cDNA

CTTAGACTCGCATCGAATTCATCTCCCAGAAATACTTAAACTATAACCACTAGCTTGCTAGCTGTGAATTTCAAGAAAGAGAAGAATGTCTAGAATTCATCCATCTTTGGAGAAAAAAACCGGATCAAACCGCCTGACAGGCGATGATCACAATCGTCTGGACCAGGTTCGAAGTCCAAAACACACGACTCTTACGGTATGGAAACGATCGAGCATGAGCTTCCATGGCACTGATGGGTTCACTGTGTATGATCACCATG...

CDS

Download CDS FASTA

837 bp · TkA05G041540|TK1151|CDS

ATGTCTAGAATTCATCCATCTTTGGAGAAAAAAACCGGATCAAACCGCCTGACAGGCGATGATCACAATCGTCTGGACCAGGTTCGAAGTCCAAAACACACGACTCTTACGGTATGGAAACGATCGAGCATGAGCTTCCATGGCACTGATGGGTTCACTGTGTATGATCACCATGGAAAGCTGGCTTTCCGCGTTGACAACTACTCCAGGAACAGCCATGTTCGAAGCCGCTGGTCTTGCTCTTCTGCCAACACTAACGG...

Protein

Download Protein FASTA

278 aa · TkA05G041540|TK1151|PROTEIN

MSRIHPSLEKKTGSNRLTGDDHNRLDQVRSPKHTTLTVWKRSSMSFHGTDGFTVYDHHGKLAFRVDNYSRNSHVRSRWSCSSANTNGGAGCGAGGAGGGALVLMDGSGNPLITLKPQILSIQNQWNGCIYREDDNLSSKSNDRIFMMRRRSSSVMGLGRTKNEQDECEAEIFFTDSESGGAGGGGGSRKLLRKPDFRIEGSFWNRNCKIKSTASGEVAAKIMRKRTAPAAVTSGSTIILSEEVFSLVVMPGFDPQLIMAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G041540`
TK1151 ID	TkA05G041540
OH-1004 ID	LXL04_035926
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	35.900
Protein coverage (%)	TK1151 33.094 / OH-1004 30.093 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G041540`
Location	Chr05:11091840-11093170 (+)
Description	Similar to At2g38640: Protein LURP-one-related 8
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035926` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	ath:AT1G80120 ath:AT2G38640 ath:AT3G14260 ath:AT3G15810 ath:AT5G41590 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.594

Rank 1 · TkA05G041540 · TK1151

Cytoplasm0.318

Rank 2 · TkA05G041540 · TK1151

Cell membrane0.238

Rank 3 · TkA05G041540 · TK1151

Endoplasmic reticulum0.091

Rank 4 · TkA05G041540 · TK1151

Lysosome / Vacuole0.032

Rank 5 · TkA05G041540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12604gp37_C17-43 aa

PF04525LOR34-72 aa

PF12604gp37_C79-171 aa

PF04525LOR100-265 aa

PF30950At1g65710154-216 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G041540	`PF12604`	gp37_C	17	43	0.046	14.6
TkA05G041540	`PF04525`	LOR	34	72	7.2e-29	102.1
TkA05G041540	`PF12604`	gp37_C	79	171	0.046	14.6
TkA05G041540	`PF04525`	LOR	100	265	7.2e-29	102.1
TkA05G041540	`PF30950`	At1g65710	154	216	0.28	10.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card