TkA05G011900 | RubberDandelionOmics

Gene overview

TkA05G011900

Reference: TK1151 Chr: Chr05 Coordinates: 3393356-3397411 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1188 bp · TkA05G011900|TK1151|cDNA

ATGGCGGGCGGAGGATTTGTGGATGGGAAAGGCGGAGCAAGGGCGGAGTATTACGAGTACAAGATCACTTGGTATTTCATATTTGCTTCCATTGTGGCTGCTCTCGGTGGTTCCCTCTTCGGTTATGATCTCGGCGTCTCCGGGGTCTTGGTGTCACAATTAGCAAAGCATAGGGAGCAAAGTGCAATTTTCCTTTTAGAATCTCATGGATACAGCGCCGCATCTTTTCCGTCAAGTTCATCTCCAGCCGGTGGCCACCA...

CDS

Download CDS FASTA

1188 bp · TkA05G011900|TK1151|CDS

ATGGCGGGCGGAGGATTTGTGGATGGGAAAGGCGGAGCAAGGGCGGAGTATTACGAGTACAAGATCACTTGGTATTTCATATTTGCTTCCATTGTGGCTGCTCTCGGTGGTTCCCTCTTCGGTTATGATCTCGGCGTCTCCGGGGTCTTGGTGTCACAATTAGCAAAGCATAGGGAGCAAAGTGCAATTTTCCTTTTAGAATCTCATGGATACAGCGCCGCATCTTTTCCGTCAAGTTCATCTCCAGCCGGTGGCCACCA...

Protein

Download Protein FASTA

395 aa · TkA05G011900|TK1151|PROTEIN

MAGGGFVDGKGGARAEYYEYKITWYFIFASIVAALGGSLFGYDLGVSGVLVSQLAKHREQSAIFLLESHGYSAASFPSSSSPAGGHHLRRAAATSKPHSPPLHAISLYENERKQPVLINSGRQLLPPLKLSTETAPPKPATRCFLSLSRCCRKSNHQTPRALLWKPRQRERERERERERERERVYGCEEEVDGGNTGGSSGLCLVRRKSALSSVHRLWLSFTNTGKEEGKRIAEKEGIAGICCSPEKCRTAGKASKGVFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G011900`
TK1151 ID	TkA05G011900
OH-1004 ID	LXL04_006743
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	92.500
Protein coverage (%)	TK1151 52.405 / OH-1004 95.928 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G011900

Location Chr05:3393356-3397411 (+)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77210`	Mediates an active uptake of hexoses, probably by sugar/hydrogen symport.	No verified direct reference in this release
`At4g02050`	Mediates an active uptake of hexoses, probably by sugar/hydrogen symport.	No verified direct reference in this release
`At3g19940`	Hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose.	STP10 encodes a high-affinity monosaccharide transporter and is induced under low-glucose conditions in pollen tubes of Arabidopsis.2016 · DOI: 10.1093/jxb/erw048 Crystal structure of the plant symporter STP10 illuminates sugar uptake mechanism in monosaccharide transporter superfamily.2019 · DOI: 10.1038/s41467-018-08176-9 Molecular mechanism of sugar transport in plants unveiled by structures of glucose/H+ symporter STP10.2021 · DOI: 10.1038/s41477-021-00992-0
`At1g50310`	Mediates an active uptake of hexoses, probably by sugar/hydrogen symport.	Functional characterization and expression analyses of the glucose-specific AtSTP9 monosaccharide transporter in pollen of Arabidopsis.2003 · DOI: 10.1104/pp.103.026674
`At5g23270`	Mediates an active uptake of hexoses, probably by sugar/hydrogen symport.	AtSTP11, a pollen tube-specific monosaccharide transporter in Arabidopsis.2005 · DOI: 10.1007/s00425-004-1420-5

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006743 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.415

Rank 1 · TkA05G011900 · TK1151

Nucleus0.322

Rank 2 · TkA05G011900 · TK1151

Cytoplasm0.279

Rank 3 · TkA05G011900 · TK1151

Endoplasmic reticulum0.085

Rank 4 · TkA05G011900 · TK1151

Mitochondrion0.038

Rank 5 · TkA05G011900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083Sugar_tr30-61 aa

PF13054DUF3915166-183 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G011900	`PF00083`	Sugar_tr	30	61	0.027	14.1
TkA05G011900	`PF13054`	DUF3915	166	183	1.8	9.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GW61`	Arabidopsis thaliana	sp\|Q8GW61\|STP14_ARATH Sugar transport protein 14	63.500%	Swiss-Prot	Low
`O04249`	Arabidopsis thaliana	sp\|O04249\|STP7_ARATH Sugar transport protein 7	54.700%	Swiss-Prot	Low
`Q9LT15`	Arabidopsis thaliana	sp\|Q9LT15\|STP10_ARATH Sugar transport protein 10	56.600%	Swiss-Prot	Low
`Q9SX48`	Arabidopsis thaliana	sp\|Q9SX48\|STP9_ARATH Sugar transport protein 9	53.800%	Swiss-Prot	Low
`Q9FMX3`	Arabidopsis thaliana	sp\|Q9FMX3\|STP11_ARATH Sugar transport protein 11	48.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card