TkA05G002700 | RubberDandelionOmics

Gene overview

TkA05G002700

Reference: TK1151 Chr: Chr05 Coordinates: 836380-838805 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1427 bp · TkA05G002700|TK1151|cDNA

GAAAAAAGAAAGAGTGTAAACCCTCGCCGGCACACCGGGAGTTCCATACCGTCCGCCTCCCAATTGCTTGCTTGCCTCGCCATGGACGCGACAGATATGGACGTAGAAGTAAATGAAGAACATAACCGCATTATTCCCGATTCCAATAGCTCGTCGAAGCGATTTGCATTAAAAAACTCCATTCAAACCAATTTCGGTGATGATTACGTTTTCCAAATCGTCCCCAAGGAAGACTGGACATCGATGGCTGTGTCTCTGTC...

CDS

Download CDS FASTA

1167 bp · TkA05G002700|TK1151|CDS

ATGGACGCGACAGATATGGACGTAGAAGTAAATGAAGAACATAACCGCATTATTCCCGATTCCAATAGCTCGTCGAAGCGATTTGCATTAAAAAACTCCATTCAAACCAATTTCGGTGATGATTACGTTTTCCAAATCGTCCCCAAGGAAGACTGGACATCGATGGCTGTGTCTCTGTCGTCCAATACCGTGAAGCTGTATTCACCGGTAACCGGTCAGTTCGTCGGAGAATGCTGCAGAGGACAGCATTCTGATAGCAT...

Protein

Download Protein FASTA

388 aa · TkA05G002700|TK1151|PROTEIN

MDATDMDVEVNEEHNRIIPDSNSSSKRFALKNSIQTNFGDDYVFQIVPKEDWTSMAVSLSSNTVKLYSPVTGQFVGECCRGQHSDSINHILFSGNILHTCSSDGTLRAWDTRSYQQVSCLNAGPSQEIFSFSFGGSGDNLLAAGCKSQILFWDWRNKKQVACLEESHLDDVTQVHFVPNEKNKLISASIDGLICTFDASGDINDDESMQSVINVETSIGKVGFFGREYEKLWCLTHIESLSIWDLKESTKEADFKEARLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G002700`
TK1151 ID	TkA05G002700
OH-1004 ID	LXL04_018883
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 90.023 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G002700

Location Chr05:836380-838805 (-)

Description Similar to GTS1: WD repeat-containing protein GTS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47790`	Involved in the control of plant growth development.	GIGANTUS1 (GTS1), a member of Transducin/WD40 protein superfamily, controls seed germination, growth and biomass accumulation through ribosome-biogenesis protein interactions in Arabidopsis thaliana.2014 · DOI: 10.1186/1471-2229-14-37

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018883 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010029 regulation of seed germination Biological Process

GO:0040008 regulation of growth Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT2G47790

bta:539045

ddi:DDB_G0283635

mmu:72338

rno:314243

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.856

Rank 1 · TkA05G002700 · TK1151

Cytoplasm0.290

Rank 2 · TkA05G002700 · TK1151

Mitochondrion0.029

Rank 3 · TkA05G002700 · TK1151

Cell membrane0.024

Rank 4 · TkA05G002700 · TK1151

Lysosome / Vacuole0.017

Rank 5 · TkA05G002700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25172Beta-prop_WDR3_2nd15-68 aa

PF24807WD40_CDC20-Fz33-256 aa

PF25168Beta-prop_WDR36-Utp21_2nd38-168 aa

PF16755Beta-prop_NUP159_NUP21439-111 aa

PF25173Beta-prop_WDR3_1st42-118 aa

PF24817WD40_WDHD1_1st43-127 aa

PF23414Beta-prop_EML_249-93 aa

PF23381Beta-prop_IFT122_1st51-247 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G002700	`PF25172`	Beta-prop_WDR3_2nd	15	68	3.5e-09	37.0
TkA05G002700	`PF24807`	WD40_CDC20-Fz	33	256	2.3e-12	47.5
TkA05G002700	`PF25168`	Beta-prop_WDR36-Utp21_2nd	38	168	1.6e-05	25.1
TkA05G002700	`PF16755`	Beta-prop_NUP159_NUP214	39	111	0.00014	22.0
TkA05G002700	`PF25173`	Beta-prop_WDR3_1st	42	118	2e-16	60.9
TkA05G002700	`PF24817`	WD40_WDHD1_1st	43	127	1.7e-08	34.7
TkA05G002700	`PF23414`	Beta-prop_EML_2	49	93	7.6e-08	32.8
TkA05G002700	`PF23381`	Beta-prop_IFT122_1st	51	247	1.4e-11	45.0
TkA05G002700	`PF25175`	Beta-prop_WDR5	53	261	7.7e-19	68.8
TkA05G002700	`PF23775`	Beta-prop_RIG_2nd	53	118	0.00025	21.3
TkA05G002700	`PF24796`	WDR55	54	247	1.4e-10	41.5
TkA05G002700	`PF24814`	WD40_Prp19	55	190	2e-12	47.5
TkA05G002700	`PF29037`	DSE1_N	55	117	1e-06	28.9
TkA05G002700	`PF00400`	WD40	56	67	3.3e-07	31.3
TkA05G002700	`PF25174`	Beta-prop_THOC3	58	160	6.5e-15	55.6
TkA05G002700	`PF23869`	Beta-prop_WDR75_1st	58	111	4.4e-05	23.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q944S2`	Arabidopsis thaliana	sp\|Q944S2\|GTS1_ARATH WD repeat-containing protein GTS1	59.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card