RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G002320
Reference: TK1151 Chr: Chr05 Coordinates: 707153-711329 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1768 bp · TkA05G002320|TK1151|cDNA

AAGCACACAATATATAATCCACACAGAGACGCGGGGAGATAGAGAGATCGGTGGTGACGGAGACGGCGACGGTGAGAACAGTCGGCGATCAACTGATGAAGACTACGATTTTGAAGAGGAAGAGGAGCGGTAGTAGCAGAAAGGAAACGCAGAAGAGGATGAAAGGTTCGCTGGCTAGACACTTATCGGCTCAGCTAGGTCAAATCTCTTTCAAGCCGCCGCTTCCTCAGAATAGTAACAATCCTTCGCGGTTTCAGAAT...

CDS

Download CDS FASTA

1107 bp · TkA05G002320|TK1151|CDS

ATGGAAGAGTTGCCTTGCCCAAGATCACCAGAGAAGTTAAAGTCTGTTAGAAGCAAAAGGCATAGAGAAGCATTTCTGAATCTGGAAGAGGATATAACAGAAGAAACTGAAACAGACAATCAACCTGTAACTGAACCTCAAGTAAGCAGACAGGGGTATGTTTCCCAATCTGCTGTGGCATTAAGATGTCGGGTAATGCCTCCTCCTTGTATGAAGAATCCTTACATAAAAGGTTCTTCAGATAATGACATTGATCCATT...

Protein

Download Protein FASTA

368 aa · TkA05G002320|TK1151|PROTEIN

MEELPCPRSPEKLKSVRSKRHREAFLNLEEDITEETETDNQPVTEPQVSRQGYVSQSAVALRCRVMPPPCMKNPYIKGSSDNDIDPFGDRRSKCAVFLPAAFSGDGLSRYRTDFHEIKQIGTGNFSCVFKALKRIDGCMYAVKCSTRKLHLDTERQKALMEVQALAALGYHDNIVGYNTSWFENEKLYIQMELCDHSLSIHHSPRPCPEGEVLEAMHQIAKALQYIHSKGIVHLDLKPENIYVKNGVYKLGDFGCSSLLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G002320
TK1151 IDTkA05G002320
OH-1004 IDLXL04_018875
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)99.700
Protein coverage (%)TK1151 100.000 / OH-1004 75.256
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G002320
LocationChr05:707153-711329 (-)
DescriptionSimilar to WEE1: Wee1-like protein kinase
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g02970 Cell cycle regulatory kinase that is not rate-limiting for cycle progression under normal growth conditions.
A WEE1 homologue from Arabidopsis thaliana.2002 · DOI: 10.1007/s00425-002-0815-4
Diverse phosphoregulatory mechanisms controlling cyclin-dependent kinase-activating kinases in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2006.02820.x
Arabidopsis WEE1 kinase controls cell cycle arrest in response to activation of the DNA integrity checkpoint.2007 · DOI: 10.1105/tpc.106.045047

Rice

Reference gene IDPossible functionPapers / DOI
Os02g0135300 Wee1-like protein kinase. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_018875 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000076 DNA replication checkpoint signaling Biological Process
GO:0000278 mitotic cell cycle Biological Process
GO:0010972 negative regulation of G2/M transition of mitotic cell cycle Biological Process
GO:0045786 negative regulation of cell cycle Biological Process
GO:0051301 cell division Biological Process
GO:0051321 meiotic cell cycle Biological Process
GO:0060631 regulation of meiosis I Biological Process
GO:1902750 negative regulation of cell cycle G2/M phase transition Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0000287 magnesium ion binding Molecular Function
GO:0004672 protein kinase activity Molecular Function
KEGG gene cross-reference
ath:AT1G02970
dosa:Os02g0135300
dre:327471
xla:398396
xla:399355
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.586
Rank 1 · TkA05G002320 · TK1151
Nucleus0.480
Rank 2 · TkA05G002320 · TK1151
Mitochondrion0.074
Rank 3 · TkA05G002320 · TK1151
Cell membrane0.067
Rank 4 · TkA05G002320 · TK1151
Endoplasmic reticulum0.042
Rank 5 · TkA05G002320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13095FTA2113-145 aa
PF00069Pkinase114-356 aa
PF07714PK_Tyr_Ser-Thr117-354 aa
PF06293Kdo214-246 aa
PF13095FTA2214-254 aa
PF14531Kinase-like218-310 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G002320PF13095FTA21131450.02315.1
TkA05G002320PF00069Pkinase1143561.3e-48166.4
TkA05G002320PF07714PK_Tyr_Ser-Thr1173549.6e-2588.1
TkA05G002320PF06293Kdo2142460.01615.4
TkA05G002320PF13095FTA22142540.02315.1
TkA05G002320PF14531Kinase-like2183100.009416.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8L4H0Arabidopsis thalianasp|Q8L4H0|WEE1_ARATH Wee1-like protein kinase63.400%Swiss-ProtHigh
Q6Z829Oryza sativa subsp. japonicasp|Q6Z829|WEE1_ORYSJ Wee1-like protein kinase58.600%Swiss-ProtHigh

JBrowse

View in Genome Browser