TkA04G509260 | RubberDandelionOmics

Gene overview

TkA04G509260

Reference: TK1151 Chr: Chr04 Coordinates: 128656893-128659202 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1798 bp · TkA04G509260|TK1151|cDNA

ATTTCAAACACTTGCTTGGAGGTAGGAGATCAAGATTTCTAGAGTCAAATCCTCTCATTCCGAGGGGAGATTTATTTCTTGATTAAGAAACAAATTTCGTATTGTAAGTTTAACATCATATTAACTCCAAGAAGAGGCACCACATATATTTATATCGTACGTAGCCTTGATCAACCCCTTTAAAGCTAGGGATACCATAGAAGAAAAAACAAATTATCATAATATGAGTAATCCAGCTAGAGGACGAGGCAATCAGAACG...

CDS

Download CDS FASTA

1401 bp · TkA04G509260|TK1151|CDS

ATGAGTAATCCAGCTAGAGGACGAGGCAATCAGAACGACAGGGATAGCCATAATGTGCATAGTGATAGCATGGAAAGTTCGTCATCGTCAAACGCACCTGTCCTAAGACCGCATACAGGTGGAGATGTTCGATGGGAAGCCATCAATTCCATAATTTCTAGAGATCATGATATTGGGCTTAGCCATTTCAAACTATTGAAGAGACTTGGGTATGGAGATATTGGTAGCGTTTATCTGGTAGAACTTAGAGGCACAAGCGC...

Protein

Download Protein FASTA

466 aa · TkA04G509260|TK1151|PROTEIN

MSNPARGRGNQNDRDSHNVHSDSMESSSSSNAPVLRPHTGGDVRWEAINSIISRDHDIGLSHFKLLKRLGYGDIGSVYLVELRGTSAFFAMKVMDKASLASRNKLLRAQTEREILGLLDHPFLPTLYSYFETDKFYCLVMEFCSGGNLHTLRQKQPHKHFTEEATRFFASEILLALEYLHMLGIVYRDLKPENVLVRDEGHIMLSDFDLSLRCSVNPTLVKSSSVHGGNHIGANGGSGGGGSGSGHVAEDDNVVQTSNQT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G509260`
TK1151 ID	TkA04G509260
OH-1004 ID	LXL04_009951
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.500
Protein coverage (%)	TK1151 89.485 / OH-1004 76.937 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G509260

Location Chr04:128656893-128659202 (+)

Description Similar to D6PKL2: Serine/threonine-protein kinase D6PKL2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79250`	Functions redundantly with AGC1-5 as signaling component in the pollen tube.	Two Arabidopsis AGC kinases are critical for the polarized growth of pollen tubes.2009 · DOI: 10.1111/j.1365-313x.2009.03792.x
`At3g12690`	Functions redundantly with AGC1-7 as signaling component in the pollen tube.	Two Arabidopsis AGC kinases are critical for the polarized growth of pollen tubes.2009 · DOI: 10.1111/j.1365-313x.2009.03792.x
`At1g16440`	Involved in root hair growth and morphogenesis.	No verified direct reference in this release
`At5g55910`	Protein kinase that regulates the auxin transport activity of PIN auxin efflux facilitators by direct phosphorylation.	The polarly localized D6 PROTEIN KINASE is required for efficient auxin transport in Arabidopsis thaliana.2009 · DOI: 10.1242/dev.028365 D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111484 Arabidopsis D6PK is a lipid domain-dependent mediator of root epidermal planar polarity.2015 · DOI: 10.1038/nplants.2015.162
`At4g26610`	Protein kinase that regulates the auxin transport activity of PIN auxin efflux facilitators by direct phosphorylation.	D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111484

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009951 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0009630 gravitropism Biological Process

GO:0009638 phototropism Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010540 basipetal auxin transport Biological Process

GO:0048766 root hair initiation Biological Process

GO:2000114 regulation of establishment of cell polarity Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009925 basal plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT4G26610

ath:AT5G47750

ath:AT5G55910

dosa:Os06g0291600

osa:4340792

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.633

Rank 1 · TkA04G509260 · TK1151

Nucleus0.308

Rank 2 · TkA04G509260 · TK1151

Cell membrane0.164

Rank 3 · TkA04G509260 · TK1151

Golgi apparatus0.058

Rank 4 · TkA04G509260 · TK1151

Lysosome / Vacuole0.051

Rank 5 · TkA04G509260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06293Kdo44-62 aa

PF13095FTA261-100 aa

PF00069Pkinase64-214 aa

PF07714PK_Tyr_Ser-Thr64-213 aa

PF03109ABC1137-210 aa

PF01163RIO1137-208 aa

PF06293Kdo157-210 aa

PF14531Kinase-like164-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G509260	`PF06293`	Kdo	44	62	0.14	12.3
TkA04G509260	`PF13095`	FTA2	61	100	0.032	14.6
TkA04G509260	`PF00069`	Pkinase	64	214	1.7e-61	208.6
TkA04G509260	`PF07714`	PK_Tyr_Ser-Thr	64	213	3.3e-28	99.4
TkA04G509260	`PF03109`	ABC1	137	210	0.0074	16.2
TkA04G509260	`PF01163`	RIO1	137	208	0.0095	16.3
TkA04G509260	`PF06293`	Kdo	157	210	0.14	12.3
TkA04G509260	`PF14531`	Kinase-like	164	208	0.073	13.0
TkA04G509260	`PF13095`	FTA2	169	195	0.032	14.6
TkA04G509260	`PF01163`	RIO1	288	314	0.0095	16.3
TkA04G509260	`PF07714`	PK_Tyr_Ser-Thr	296	391	3.3e-28	99.4
TkA04G509260	`PF00069`	Pkinase	297	403	1.7e-61	208.6
TkA04G509260	`PF14531`	Kinase-like	323	348	0.073	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1PFB9`	Arabidopsis thaliana	sp\|Q1PFB9\|AGC17_ARATH Serine/threonine-protein kinase AGC1-7	77.600%	Swiss-Prot	High
`Q9LTW5`	Arabidopsis thaliana	sp\|Q9LTW5\|AGC15_ARATH Serine/threonine-protein kinase AGC1-5	71.500%	Swiss-Prot	High
`F4I4F2`	Arabidopsis thaliana	sp\|F4I4F2\|RHS3_ARATH Serine/threonine-protein kinase RHS3	71.100%	Swiss-Prot	High
`Q9FG74`	Arabidopsis thaliana	sp\|Q9FG74\|D6PK_ARATH Serine/threonine-protein kinase D6PK	65.600%	Swiss-Prot	High
`Q9SUA3`	Arabidopsis thaliana	sp\|Q9SUA3\|D6KL1_ARATH Serine/threonine-protein kinase D6PKL1	63.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card