TkA04G505220 | RubberDandelionOmics

Gene overview

TkA04G505220

Reference: TK1151 Chr: Chr04 Coordinates: 127619218-127620955 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

558 bp · TkA04G505220|TK1151|cDNA

ATGAAGAGAAATCACTCACTCTATCTACGCACAAACACACATACAACTCATCTACCACCACTTCCTCTTCCACAAATGATATTGCCTTTGCTTTTCCTCTCCGCTACATACGCCGCATCCCCTGATCTTTCTCTCGAAGATAAAGATCCAATGTACCCACCTTCTCAATCATGGCTGCCATCACCCACCATGAACTACATCGTGAAATGCACTACCATACAGTCTCACCTTTGTCTCTCTAATTCAAAGGCTCTCTATGC...

CDS

Download CDS FASTA

558 bp · TkA04G505220|TK1151|CDS

ATGAAGAGAAATCACTCACTCTATCTACGCACAAACACACATACAACTCATCTACCACCACTTCCTCTTCCACAAATGATATTGCCTTTGCTTTTCCTCTCCGCTACATACGCCGCATCCCCTGATCTTTCTCTCGAAGATAAAGATCCAATGTACCCACCTTCTCAATCATGGCTGCCATCACCCACCATGAACTACATCGTGAAATGCACTACCATACAGTCTCACCTTTGTCTCTCTAATTCAAAGGCTCTCTATGC...

Protein

Download Protein FASTA

185 aa · TkA04G505220|TK1151|PROTEIN

MKRNHSLYLRTNTHTTHLPPLPLPQMILPLLFLSATYAASPDLSLEDKDPMYPPSQSWLPSPTMNYIVKCTTIQSHLCLSNSKALYANTSISTRMKGATKAMVAMNKYIFISFFSFLEMAPAKQVKVIKEFQKQSSQLDMTIEMMSESIDETLDKDEAEEETEELTNQEMPKYYRSINQENWKGL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G505220`
TK1151 ID	TkA04G505220
OH-1004 ID	LXL04_039118
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 77.297 / OH-1004 73.333 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G505220

Location Chr04:127619218-127620955 (+)

Description Similar to VPS2.2: Vacuolar protein sorting-associated protein 2 homolog 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44560`	Component of the ESCRT-III complex, which is required for multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release
`At1g03950`	Component of the ESCRT-III complex, which is required for multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039118 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0032509 endosome transport via multivesicular body sorting pathway Biological Process

GO:0045324 late endosome to vacuole transport Biological Process

GO:0000815 ESCRT III complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005771 multivesicular body Cellular Component

GO:0005829 cytosol Cellular Component

GO:0031902 late endosome membrane Cellular Component

KEGG gene cross-reference

ath:AT1G03950

ath:AT5G44560

ddi:DDB_G0292400

dre:405840

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.372

Rank 1 · TkA04G505220 · TK1151

Nucleus0.345

Rank 2 · TkA04G505220 · TK1151

Mitochondrion0.237

Rank 3 · TkA04G505220 · TK1151

Endoplasmic reticulum0.079

Rank 4 · TkA04G505220 · TK1151

Cell membrane0.075

Rank 5 · TkA04G505220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03357Snf784-169 aa

PF27815C24B10_03117-177 aa

PF00542Ribosomal_L12117-166 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G505220	`PF03357`	Snf7	84	169	9.6e-05	22.8
TkA04G505220	`PF27815`	C24B10_03	117	177	0.079	14.3
TkA04G505220	`PF00542`	Ribosomal_L12	117	166	0.79	10.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WTY4`	Arabidopsis thaliana	sp\|Q0WTY4\|VPS2B_ARATH Vacuolar protein sorting-associated protein 2 homolog 2	66.700%	Swiss-Prot	Low
`Q941D5`	Arabidopsis thaliana	sp\|Q941D5\|VPS2C_ARATH Vacuolar protein sorting-associated protein 2 homolog 3	50.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card