TkA04G504350 | RubberDandelionOmics

Gene overview

TkA04G504350

Reference: TK1151 Chr: Chr04 Coordinates: 127383919-127386300 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2114 bp · TkA04G504350|TK1151|cDNA

TACTCTTTTTGGTCCCACTACTTCAGCCACCACGTCATCTTCCGTCAATCTGCCTTTATCTATCTCTCTCTCTCTAGAATTCTAGGGTTCGTTCTTCTTCTTCTCATTCTCCTTCTCTCGTCCATGCCGTAATCTCTGATTCCAGATTCGCGATATGGGTTCGATTTCGATCCCCGATCCCGGTGAATCGATTCAGACACCAAGCTTCGATGAATTCCAACGACAGACATCACTCATGACCAGCTGCACTCTTCTCTGGA...

CDS

Download CDS FASTA

1572 bp · TkA04G504350|TK1151|CDS

ATGGGTTCGATTTCGATCCCCGATCCCGGTGAATCGATTCAGACACCAAGCTTCGATGAATTCCAACGACAGACATCACTCATGACCAGCTGCACTCTTCTCTGGAAAGAGCTATCAGATCACTTCACTTCTCTGGAACAAAGCCTCCTAAAGAAATCAGATGCGATCAAGGACAAGATCAAGACCCTAGACACCGAAACTAAAGTCTCCCTAAGTTCTCTCGAGGAGCGAGAAACAACGATCGAAAATTCCGTTTCCAT...

Protein

Download Protein FASTA

523 aa · TkA04G504350|TK1151|PROTEIN

MGSISIPDPGESIQTPSFDEFQRQTSLMTSCTLLWKELSDHFTSLEQSLLKKSDAIKDKIKTLDTETKVSLSSLEERETTIENSVSIALRNVEAAVQAAAAAVGTSKCDDGEDNPEVDDSEGLLLRLKSYCVKMDSLGFWGFVASRKKEMDLMRAQVPLALAVCADPARFVLEAISEVFPVDKRAVCMNDLSWACVLILESLIPVMVDPILGNSRVLVTPSVKKSAKEIAEMWKESLDQRGGIENVKAPDVHTFFQHLVT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G504350`
TK1151 ID	TkA04G504350
OH-1004 ID	LXL04_039098
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G504350

Location Chr04:127383919-127386300 (+)

Description Similar to FRL4A: FRIGIDA-like protein 4a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g22440`	FRIGIDA-like protein 4a.	No verified direct reference in this release
`At4g14900`	FRIGIDA-like protein 4b.	No verified direct reference in this release
`UniProt: P0DH90`	Required for the regulation of flowering time in the late-flowering phenotype.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039098 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009908 flower development Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0030154 cell differentiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G31814

ath:AT3G22440

ath:AT4G14900

ath:AT5G48385

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.957

Rank 1 · TkA04G504350 · TK1151

Cytoplasm0.093

Rank 2 · TkA04G504350 · TK1151

Cell membrane0.034

Rank 3 · TkA04G504350 · TK1151

Endoplasmic reticulum0.021

Rank 4 · TkA04G504350 · TK1151

Plastid0.014

Rank 5 · TkA04G504350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00804Syntaxin19-71 aa

PF11727ISG65-7529-132 aa

PF04513Baculo_PEP_C36-98 aa

PF07899Frigida125-408 aa

PF28069HetP185-200 aa

PF11727ISG65-75331-399 aa

PF00804Syntaxin388-421 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G504350	`PF00804`	Syntaxin	19	71	1.3	9.5
TkA04G504350	`PF11727`	ISG65-75	29	132	0.0039	17.6
TkA04G504350	`PF04513`	Baculo_PEP_C	36	98	0.32	11.8
TkA04G504350	`PF07899`	Frigida	125	408	1.2e-101	340.5
TkA04G504350	`PF28069`	HetP	185	200	0.16	12.3
TkA04G504350	`PF11727`	ISG65-75	331	399	0.0039	17.6
TkA04G504350	`PF00804`	Syntaxin	388	421	1.3	9.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LUV4`	Arabidopsis thaliana	sp\|Q9LUV4\|FRL4A_ARATH FRIGIDA-like protein 4a	67.100%	Swiss-Prot	High
`Q940H8`	Arabidopsis thaliana	sp\|Q940H8\|FRL4B_ARATH FRIGIDA-like protein 4b	65.800%	Swiss-Prot	High
`P0DH90`	Arabidopsis thaliana	sp\|P0DH90\|FRIGI_ARATH Protein FRIGIDA	25.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card