TkA04G499970 | RubberDandelionOmics

Gene overview

TkA04G499970

Reference: TK1151 Chr: Chr04 Coordinates: 126230668-126238982 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1228 bp · TkA04G499970|TK1151|cDNA

TAACAATAGGTTACATACAGTAACCGGTCACCAAGATTAACAAGTCCAAGTCAAGGTCGTTCAACTTCTTCTTCAACGTTCGATTACCCTTTCAGCCATCTTTCAGCCATCTCCTCCTCATTCGATTACCCTTTCACCAAATACGGCAGATAGATTCAAACATTCGGAGCCTTGATGATCTTGTCATCCACGCGAATACTTCTGGTGAAGAACTCAACACTGATTTCAAGCAGGAGCATAGGCTGAAATCATAAACTCAA...

CDS

Download CDS FASTA

612 bp · TkA04G499970|TK1151|CDS

ATGCCTACGGCGAACACCAGCAGTCCAGCACCTTGCAGCACAAGATCATGGTCTATCAGCGATGATTCGTTGAGAAGATACGTTTTCTTCGCAAGTGAGAGCTGTATCCAGGAGCTATTATCTGCGTCAGATTCCAACAGGGCTGGCAACGGTAACGATGGATGGAAGGTTCTGGGCTTTGAAGACGGGGTCGAGATATCAAAACGTCGGTCTGGATCTGGATCGTTTCACGCATTTAGAAGCCGATGGTTGCTTAAATC...

Protein

Download Protein FASTA

203 aa · TkA04G499970|TK1151|PROTEIN

MPTANTSSPAPCSTRSWSISDDSLRRYVFFASESCIQELLSASDSNRAGNGNDGWKVLGFEDGVEISKRRSGSGSFHAFRSRWLLKSVSTEQFITVANAIDAAKQWDSDLVEARYIKDLDENLSIIKLRFGESSKPVFRNREFVVYERRETMDDGTLVVAVASLPKEIAAGLQPKQNNSIRGLLLQSGWVLKSLMMIHAWSLM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G499970`
TK1151 ID	TkA04G499970
OH-1004 ID	LXL04_039053
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.900
Protein coverage (%)	TK1151 95.567 / OH-1004 55.429 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G499970`
Location	Chr04:126230668-126238982 (+)
Description	Similar to Stard10: START domain-containing protein 10
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_039053` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006656 phosphatidylcholine biosynthetic process Biological Process GO:0006869 lipid transport Biological Process GO:0032782 bile acid secretion Biological Process GO:0035360 positive regulation of peroxisome proliferator activated receptor signaling pathway Biological Process GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0031514 motile cilium Cellular Component GO:0046581 intercellular canaliculus Cellular Component GO:0005319 lipid transporter activity Molecular Function GO:0008289 lipid binding Molecular Function GO:0031210 phosphatidylcholine binding Molecular Function
KEGG gene cross-reference	hsa:10809 mmu:56018 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.375

Rank 1 · TkA04G499970 · TK1151

Nucleus0.370

Rank 2 · TkA04G499970 · TK1151

Cell membrane0.153

Rank 3 · TkA04G499970 · TK1151

Endoplasmic reticulum0.127

Rank 4 · TkA04G499970 · TK1151

Plastid0.078

Rank 5 · TkA04G499970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01852START74-192 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G499970	`PF01852`	START	74	192	1.4e-05	25.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card