Gene Card
Gene overview
cDNA / CDS / Protein Sequences
710 bp · TkA04G489110|TK1151|cDNA
ATGATGCTTTCAAGACCCTTTATAGAATATTGTTTATGGGATGGGATAACTTTCCAAGAATTGTCCTCATGTATTATGCCAACTTTCTTTCATCTCCTTGAAGGCTATTTCCACAATGTAATTTGTAATGCGGAAGAGTTCAAGAACACAACTGAAGCAGCATGGGATCCTAATGGGCGTATGATTCTTATTGCTTTTTCAGAATCTTTAACATTAAGTTCTATTCACTTTGCTACAAAACCTCAATTACTTGATGCACA...
588 bp · TkA04G489110|TK1151|CDS
ATGATGCTTTCAAGACCCTTTATAGAATATTGTTTATGGGATGGGATAACTTTCCAAGAATTGTCCTCATGTATTATGCCAACTTTCTTTCATCTCCTTGAAGGCTATTTCCACAATGTAATTTGTAATGCGGAAGAGTTCAAGAACACAACTGAAGCAGCATGGGATCCTAATGGGCGTATGATTCTTATTGCTTTTTCAGAATCTTTAACATTAAGTTCTATTCACTTTGCTACAAAACCTCAATTACTTGATGCACA...
Protein
Download Protein FASTA195 aa · TkA04G489110|TK1151|PROTEIN
MMLSRPFIEYCLWDGITFQELSSCIMPTFFHLLEGYFHNVICNAEEFKNTTEAAWDPNGRMILIAFSESLTLSSIHFATKPQLLDAHLLPVELPKLESLTKGIEKIAWDATGERLVVAYKDGNELYKGLIATYDVKRATIITSSLIGFIRGPGEDPKPLTFSFHDKYKQDPLLSVVWITGSCVTYPLLIRSHLLA
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G489110 |
|---|---|
| TK1151 ID | TkA04G489110 |
| OH-1004 ID | LXL04_036173 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 90.500 |
| Protein coverage (%) | TK1151 74.359 / OH-1004 34.917Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G489110 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:123685641-123686842 (-) | |||||||||
| Description | Similar to AAAS: Aladin | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001578 microtubule bundle formation Biological Process GO:0006749 glutathione metabolic process Biological Process GO:0006913 nucleocytoplasmic transport Biological Process GO:0006979 response to oxidative stress Biological Process GO:0009566 fertilization Biological Process GO:0015031 protein transport Biological Process GO:0035264 multicellular organism growth Biological Process GO:0046822 regulation of nucleocytoplasmic transport Biological Process GO:0051028 mRNA transport Biological Process GO:0090307 mitotic spindle assembly Biological Process GO:1902365 positive regulation of protein localization to spindle pole body Biological Process GO:0000922 spindle pole Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT3G56900 dme:Dmel_CG16892 hsa:8086 mmu:223921 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02485Branch1-51 aaPF24797Beta-prop_WDR35_TULP_N34-68 aaPF02974Inh42-66 aaPF12894ANAPC4_WD4048-69 aaPF25174Beta-prop_THOC349-123 aaPF25460Beta-prop_Aladin51-187 aaPF21544PorZ_N_b_propeller51-68 aaPF06977SdiA-regulated71-119 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G489110 | PF02485 | Branch | 1 | 51 | 0.00029 | 21.2 |
| TkA04G489110 | PF24797 | Beta-prop_WDR35_TULP_N | 34 | 68 | 0.075 | 12.9 |
| TkA04G489110 | PF02974 | Inh | 42 | 66 | 0.16 | 12.7 |
| TkA04G489110 | PF12894 | ANAPC4_WD40 | 48 | 69 | 0.0001 | 23.2 |
| TkA04G489110 | PF25174 | Beta-prop_THOC3 | 49 | 123 | 0.29 | 10.8 |
| TkA04G489110 | PF25460 | Beta-prop_Aladin | 51 | 187 | 1.7e-11 | 44.5 |
| TkA04G489110 | PF21544 | PorZ_N_b_propeller | 51 | 68 | 0.12 | 13.3 |
| TkA04G489110 | PF06977 | SdiA-regulated | 71 | 119 | 0.25 | 11.2 |
| TkA04G489110 | PF12894 | ANAPC4_WD40 | 100 | 123 | 0.0001 | 23.2 |
| TkA04G489110 | PF21544 | PorZ_N_b_propeller | 101 | 123 | 0.12 | 13.3 |
| TkA04G489110 | PF24797 | Beta-prop_WDR35_TULP_N | 103 | 123 | 0.075 | 12.9 |
| TkA04G489110 | PF02974 | Inh | 106 | 126 | 0.16 | 12.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.