TkA04G475350 | RubberDandelionOmics

Gene overview

TkA04G475350

Reference: TK1151 Chr: Chr04 Coordinates: 120040667-120043051 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1154 bp · TkA04G475350|TK1151|cDNA

TTGACTCATTAACTATCGGCGGCGTAAGGAGAATGGTATGCGTCTTTTCCAGTCCGATTCAGGGTTAACGAGTTTCAGTTTCGTATACAGGGTTTCAGTCCGATTCTACACTCGCGCCTCTTTCTCCAGGGTTTGTCGGAGACATCGTCGACGATAATGGAGGAAGTAAACTACGATGAAGTTTTTTCGAGCGTTCCTTACGCAGCAGATCACGGAAAACTGGATAACGGACTCTCCTACTATGTAAGACGGAATTCTAA...

CDS

Download CDS FASTA

774 bp · TkA04G475350|TK1151|CDS

ATGGAGGAAGTAAACTACGATGAAGTTTTTTCGAGCGTTCCTTACGCAGCAGATCACGGAAAACTGGATAACGGACTCTCCTACTATGTAAGACGGAATTCTAACCCCGAAGGCAAAGCCGCGCTCTCACTGGCCGTGAACGTAGGACCTATGGTGGAAGAGCGATCTCATGTCCACCTGAGCTTCCCGTTTGAGTTAGGGGATAGAGGAAAGATCTACAAAATTTCGGTGTTGGTCTTTCTTCGTTGCAACAAACCAGG...

Protein

Download Protein FASTA

257 aa · TkA04G475350|TK1151|PROTEIN

MEEVNYDEVFSSVPYAADHGKLDNGLSYYVRRNSNPEGKAALSLAVNVGPMVEERSHVHLSFPFELGDRGKIYKISVLVFLRCNKPGIVGRARGDMSIGFSCHPDLAETLVDASLDEIERFQAEGPSDADISVVLESYRQLYETGLQDNKWWLERIVEAYKSSYSGEVGLGVASSVKIEEDLRSEAIHTFTPPVARSALQRLLPFPCKSLFTAVIRSPYEASRSRMIRSIITDPKVLAGMVVVASFLWRYFRTSSRV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G475350`
TK1151 ID	TkA04G475350
OH-1004 ID	LXL04_018620
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	45.400
Protein coverage (%)	TK1151 80.156 / OH-1004 23.253 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G475350

Location Chr04:120040667-120043051 (+)

Description Similar to At5g56730: Zinc protease PQQL-like

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56730`	Zinc protease PQQL-like.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018620 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016485 protein processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0004222 metalloendopeptidase activity Molecular Function

GO:0008233 peptidase activity Molecular Function

GO:0008237 metallopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G42390

ecj:JW1489

eco:b1494

hin:HI_1368

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.262

Rank 1 · TkA04G475350 · TK1151

Plastid0.253

Rank 2 · TkA04G475350 · TK1151

Cytoplasm0.216

Rank 3 · TkA04G475350 · TK1151

Nucleus0.132

Rank 4 · TkA04G475350 · TK1151

Peroxisome0.077

Rank 5 · TkA04G475350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28265Acyl_LnsA86-151 aa

PF05193Peptidase_M16_C92-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G475350	`PF28265`	Acyl_LnsA	86	151	0.086	13.3
TkA04G475350	`PF05193`	Peptidase_M16_C	92	132	0.089	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJT9`	Arabidopsis thaliana	sp\|Q9FJT9\|PQQL_ARATH Zinc protease PQQL-like	38.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card