TkA04G453990 | RubberDandelionOmics

Gene overview

TkA04G453990

Reference: TK1151 Chr: Chr04 Coordinates: 114428777-114432995 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

761 bp · TkA04G453990|TK1151|cDNA

TTTGTACCCACTCGATTCAACAGAAATCGTACAGTATAATAGCAGTAGTTGTTCAATGTTCATATATGGACCTTCCTTTTGACTTTTCTTCATAATTCTTATATCGGATTACGACCTTCTTGCCGATTTAAGCTTTTAGGGCTGCAAATTCTATCGTTTTCCGGTTGATGAACAAGAAGGCGATCATGAAGATGAGGGGATTCATGTGCCAGTCACAGGATGGAACGGCGTCGTGCATAAGACCCGACTGCCGGCCGTCG...

CDS

Download CDS FASTA

504 bp · TkA04G453990|TK1151|CDS

ATGAACAAGAAGGCGATCATGAAGATGAGGGGATTCATGTGCCAGTCACAGGATGGAACGGCGTCGTGCATAAGACCCGACTGCCGGCCGTCGGCGATTGTGCCACGGAGGTCGATTGATCGGACATTGGTGGAACACGGGAGGTTATTGAGCAATGCCAAGTACATTCAACTTGCGGAGCGTCGTGGGTATGTTGTTCCGGCGAGGAGATCGTCGTCGGCCAGCAGTTCGTCCTCTGACCGCCATGATCGTGTGAAATT...

Protein

Download Protein FASTA

167 aa · TkA04G453990|TK1151|PROTEIN

MNKKAIMKMRGFMCQSQDGTASCIRPDCRPSAIVPRRSIDRTLVEHGRLLSNAKYIQLAERRGYVVPARRSSSASSSSSDRHDRVKLDQHALPLSTASQVFQVVVMRVSIHCHGCAGKVKKHLSKMEGVTSFNIDLETKRVTVMGHVSPVAVLESMSKVKKAEFWHC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G453990`
TK1151 ID	TkA04G453990
OH-1004 ID	LXL04_038663
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 97.093 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G453990

Location Chr04:114428777-114432995 (+)

Description Similar to NAKR1: Protein SODIUM POTASSIUM ROOT DEFECTIVE 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02600`	Required for root meristem maintenance after germination.	Arabidopsis NPCC6/NaKR1 is a phloem mobile metal binding protein necessary for phloem function and root meristem maintenance.2010 · DOI: 10.1105/tpc.110.080010 NaKR1 regulates long-distance movement of FLOWERING LOCUS T in Arabidopsis.2016 · DOI: 10.1038/nplants.2016.75
`At3g53530`	Heavy metal-associated protein involved in salt tolerance.	Overexpression of NaKR3 enhances salt tolerance in Arabidopsis.2016 · DOI: 10.4238/gmr.15016378
`At2g37390`	Protein SODIUM POTASSIUM ROOT DEFECTIVE 2.	No verified direct reference in this release
`At5g27690`	Heavy-metal-binding protein.	No verified direct reference in this release
`At3g56891`	Heavy-metal-binding protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038663 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006825 copper ion transport Biological Process

GO:0006878 intracellular copper ion homeostasis Biological Process

GO:0009908 flower development Biological Process

GO:0010015 root morphogenesis Biological Process

GO:0010233 phloem transport Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0055078 sodium ion homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT1G66240

ath:AT2G37390

ath:AT3G53530

ath:AT3G56240

ath:AT5G02600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.421

Rank 1 · TkA04G453990 · TK1151

Nucleus0.410

Rank 2 · TkA04G453990 · TK1151

Cell membrane0.186

Rank 3 · TkA04G453990 · TK1151

Endoplasmic reticulum0.087

Rank 4 · TkA04G453990 · TK1151

Mitochondrion0.082

Rank 5 · TkA04G453990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19803DUF628632-43 aa

PF19803DUF628690-145 aa

PF00403HMA106-159 aa

PF04972BON117-148 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G453990	`PF19803`	DUF6286	32	43	0.071	14.3
TkA04G453990	`PF19803`	DUF6286	90	145	0.071	14.3
TkA04G453990	`PF00403`	HMA	106	159	1.4e-14	54.9
TkA04G453990	`PF04972`	BON	117	148	0.075	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LDS4`	Arabidopsis thaliana	sp\|Q8LDS4\|NAKR1_ARATH Protein SODIUM POTASSIUM ROOT DEFECTIVE 1	70.300%	Swiss-Prot	Low
`Q8RXH8`	Arabidopsis thaliana	sp\|Q8RXH8\|NAKR3_ARATH Protein SODIUM POTASSIUM ROOT DEFECTIVE 3	64.400%	Swiss-Prot	Low
`Q58FZ0`	Arabidopsis thaliana	sp\|Q58FZ0\|NAKR2_ARATH Protein SODIUM POTASSIUM ROOT DEFECTIVE 2	62.500%	Swiss-Prot	Low
`Q84J88`	Arabidopsis thaliana	sp\|Q84J88\|HIP36_ARATH Heavy metal-associated isoprenylated plant protein 36	48.400%	Swiss-Prot	Low
`B3H6D0`	Arabidopsis thaliana	sp\|B3H6D0\|HIP45_ARATH Heavy metal-associated isoprenylated plant protein 45	35.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card