TkA04G425810 | RubberDandelionOmics

Gene overview

TkA04G425810

Reference: TK1151 Chr: Chr04 Coordinates: 107445864-107447068 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1080 bp · TkA04G425810|TK1151|cDNA

ATGCCTGGAAGCTTAGAGCCTTTGGATGTAGGTGTTCAGATCCCGTATCATTTCAGGTGTCCGATTTCTCTTGAGCTTATGAGAGACCCGGTTATCGTCGGCACCGGTCAGACGTATGACCGGCCAAGCATCGAGTCATGGGAATGGTGTGTTGCTAATAGGTCGTACGGCGTGGAGCGGATTCCGACGCCGAAACAACCAGCGGATCCTGTTATGGTCCGGTCCTTGCTCAGCCAGGCTGCCTCTGAGTCTATTTCTAG...

CDS

Download CDS FASTA

1080 bp · TkA04G425810|TK1151|CDS

ATGCCTGGAAGCTTAGAGCCTTTGGATGTAGGTGTTCAGATCCCGTATCATTTCAGGTGTCCGATTTCTCTTGAGCTTATGAGAGACCCGGTTATCGTCGGCACCGGTCAGACGTATGACCGGCCAAGCATCGAGTCATGGGAATGGTGTGTTGCTAATAGGTCGTACGGCGTGGAGCGGATTCCGACGCCGAAACAACCAGCGGATCCTGTTATGGTCCGGTCCTTGCTCAGCCAGGCTGCCTCTGAGTCTATTTCTAG...

Protein

Download Protein FASTA

359 aa · TkA04G425810|TK1151|PROTEIN

MPGSLEPLDVGVQIPYHFRCPISLELMRDPVIVGTGQTYDRPSIESWEWCVANRSYGVERIPTPKQPADPVMVRSLLSQAASESISSHARLSALRRLRGLARDSDKNRSVISTHNAREVLLGVLFSETNSNSSELNLESLAILSSFPLSESECLLVSSDPNRISYLIALLSHPSIDVRVNAASLLENVVAGTRSPENRAEISNHDEVFDRIVGILNYPLSYPRAMKVGIKALFALCLVKQHRHKAVDAGAVEALINRLAD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G425810`
TK1151 ID	TkA04G425810
OH-1004 ID	LXL04_038411
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.000
Protein coverage (%)	TK1151 93.315 / OH-1004 87.351 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G425810

Location Chr04:107445864-107447068 (+)

Description Similar to PUB26: U-box domain-containing protein 26

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49780`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At3g19380`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At2g35930`	E3 ubiquitin-protein ligase that negatively regulates water stress response.	Arabidopsis PUB22 and PUB23 are homologous U-Box E3 ubiquitin ligases that play combinatory roles in response to drought stress.2008 · DOI: 10.1105/tpc.108.060699 Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.2008 · DOI: 10.1016/j.cub.2008.07.085
`At3g52450`	E3 ubiquitin-protein ligase that negatively regulates water stress response.	Arabidopsis PUB22 and PUB23 are homologous U-Box E3 ubiquitin ligases that play combinatory roles in response to drought stress.2008 · DOI: 10.1105/tpc.108.060699 Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.2008 · DOI: 10.1016/j.cub.2008.07.085 The ubiquitin ligase PUB22 targets a subunit of the exocyst complex required for PAMP-triggered responses in Arabidopsis.2012 · DOI: 10.1105/tpc.112.104463
`At5g37490`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038411 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002679 respiratory burst involved in defense response Biological Process

GO:0006952 defense response Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G49780

ath:AT2G35930

ath:AT3G19380

ath:AT3G52450

ath:AT5G37490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.543

Rank 1 · TkA04G425810 · TK1151

Cytoplasm0.461

Rank 2 · TkA04G425810 · TK1151

Cell membrane0.097

Rank 3 · TkA04G425810 · TK1151

Endoplasmic reticulum0.053

Rank 4 · TkA04G425810 · TK1151

Lysosome / Vacuole0.027

Rank 5 · TkA04G425810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04564U-box14-48 aa

PF13445zf-RING_UBOX20-47 aa

PF25598ARM_PUB73-334 aa

PF24768ARM_ARMC576-189 aa

PF12331Rad26-like_helical_rpts86-114 aa

PF25571TPR_CCP1_N92-143 aa

PF13513HEAT_EZ92-105 aa

PF12331Rad26-like_helical_rpts129-172 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G425810	`PF04564`	U-box	14	48	3.1e-10	40.8
TkA04G425810	`PF13445`	zf-RING_UBOX	20	47	0.29	11.9
TkA04G425810	`PF25598`	ARM_PUB	73	334	5.4e-63	214.0
TkA04G425810	`PF24768`	ARM_ARMC5	76	189	4.2e-10	40.2
TkA04G425810	`PF12331`	Rad26-like_helical_rpts	86	114	0.071	13.2
TkA04G425810	`PF25571`	TPR_CCP1_N	92	143	0.049	13.4
TkA04G425810	`PF13513`	HEAT_EZ	92	105	0.1	13.9
TkA04G425810	`PF12331`	Rad26-like_helical_rpts	129	172	0.071	13.2
TkA04G425810	`PF08216`	CTNNBL	138	234	0.15	11.2
TkA04G425810	`PF13513`	HEAT_EZ	143	187	0.1	13.9
TkA04G425810	`PF02985`	HEAT	164	189	0.012	16.5
TkA04G425810	`PF00514`	Arm	166	188	2.5e-06	28.0
TkA04G425810	`PF12331`	Rad26-like_helical_rpts	175	219	0.071	13.2
TkA04G425810	`PF24768`	ARM_ARMC5	199	322	4.2e-10	40.2
TkA04G425810	`PF25571`	TPR_CCP1_N	224	268	0.049	13.4
TkA04G425810	`PF00514`	Arm	242	258	2.5e-06	28.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FXA4`	Arabidopsis thaliana	sp\|Q9FXA4\|PUB26_ARATH U-box domain-containing protein 26	57.800%	Swiss-Prot	High
`Q9LT79`	Arabidopsis thaliana	sp\|Q9LT79\|PUB25_ARATH U-box domain-containing protein 25	58.400%	Swiss-Prot	High
`Q84TG3`	Arabidopsis thaliana	sp\|Q84TG3\|PUB23_ARATH E3 ubiquitin-protein ligase PUB23	31.200%	Swiss-Prot	Medium
`Q9SVC6`	Arabidopsis thaliana	sp\|Q9SVC6\|PUB22_ARATH E3 ubiquitin-protein ligase PUB22	28.200%	Swiss-Prot	Low
`Q5PNY6`	Arabidopsis thaliana	sp\|Q5PNY6\|PUB21_ARATH U-box domain-containing protein 21	28.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card