TkA04G425420 | RubberDandelionOmics

Gene overview

TkA04G425420

Reference: TK1151 Chr: Chr04 Coordinates: 107334872-107343967 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2615 bp · TkA04G425420|TK1151|cDNA

GTCTTCCCTGAGCATAAAAAGTCGGGGCGAAATCAGTCAAAGCATCCCTCGCTGCTCACACACGCATCTGTCACGTAAGCGGATTTCACTAACGTACGCAGCAGCGATTCCCTTCTTCCTGCATCTCATTTTCAACAACAATGGTGAAACACAGATGGATGTTACTCGTATTGTCTCTGCTATTGCTTGTAATAATGGAGTTTTCTCCTGCAATGGCAGCTACAGGTTGCCCCTTGGACGTAACTGGTTCAAATCTCACG...

CDS

Download CDS FASTA

1998 bp · TkA04G425420|TK1151|CDS

ATGGTGAAACACAGATGGATGTTACTCGTATTGTCTCTGCTATTGCTTGTAATAATGGAGTTTTCTCCTGCAATGGCAGCTACAGGTTGCCCCTTGGACGTAACTGGTTCAAATCTCACGCAAGCTGCAATCCTCTGTTCCAACACAGAATCTAGAGCAAGTTGTTGTCGTTACATCAACGCTCTTGTTGCAGTTTCCATTGTTCATTATGCAAACGAAACCAACACTCTTGGAGTCCCTCCAGAATTATCCAAAATTTG...

Protein

Download Protein FASTA

665 aa · TkA04G425420|TK1151|PROTEIN

MVKHRWMLLVLSLLLLVIMEFSPAMAATGCPLDVTGSNLTQAAILCSNTESRASCCRYINALVAVSIVHYANETNTLGVPPELSKICLKTITDTLELHGMTRNATLLCGLGTKIPVNYECLGRTMVNQMLESPKFSNVTLNCKVPFGENGCKKCLNSGILFIRNLIGSVNSNTTLSTCRDATFVSLATQVDDVSAFEIADCFFGVHGLTDTPFLGSFPPTLSPESSPTPSSQLSLTAPNLPKRHSYHLTLIPGIGIGVIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G425420`
TK1151 ID	TkA04G425420
OH-1004 ID	LXL04_038406
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G425420

Location Chr04:107334872-107343967 (-)

Description Similar to At1g49730: Probable receptor-like protein kinase At1g49730

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49730`	Probable receptor-like protein kinase At1g49730.	No verified direct reference in this release
`At5g54590`	Required for cold tolerance, via the activation of MAP kinases activity.	Phosphorylation of Arabidopsis thaliana MEKK1 via Ca(2+) signaling as a part of the cold stress response.2013 · DOI: 10.1007/s10265-013-0576-0
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At3g24790`	May be involved in plant defense signaling.	No verified direct reference in this release
`At5g02800`	Serine/threonine-protein kinase involved in the positive regulation of brassinosteroid (BR) signaling and plant growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038406 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009409 response to cold Biological Process

GO:0009631 cold acclimation Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G49730

ath:AT3G07070

ath:AT5G38560

ath:AT5G54590

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.851

Rank 1 · TkA04G425420 · TK1151

Endoplasmic reticulum0.089

Rank 2 · TkA04G425420 · TK1151

Cytoplasm0.081

Rank 3 · TkA04G425420 · TK1151

Nucleus0.056

Rank 4 · TkA04G425420 · TK1151

Lysosome / Vacuole0.032

Rank 5 · TkA04G425420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08525OapA_N3-19 aa

PF19160SPARK27-178 aa

PF08525OapA_N239-244 aa

PF08525OapA_N254-268 aa

PF27946C1orf162260-301 aa

PF07714PK_Tyr_Ser-Thr321-585 aa

PF00069Pkinase322-584 aa

PF01636APH363-465 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G425420	`PF08525`	OapA_N	3	19	0.014	16.0
TkA04G425420	`PF19160`	SPARK	27	178	1.1e-18	68.8
TkA04G425420	`PF08525`	OapA_N	239	244	0.014	16.0
TkA04G425420	`PF08525`	OapA_N	254	268	0.014	16.0
TkA04G425420	`PF27946`	C1orf162	260	301	0.17	12.5
TkA04G425420	`PF07714`	PK_Tyr_Ser-Thr	321	585	2.8e-44	152.1
TkA04G425420	`PF00069`	Pkinase	322	584	5.3e-47	161.1
TkA04G425420	`PF01636`	APH	363	465	0.031	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FX99`	Arabidopsis thaliana	sp\|Q9FX99\|Y1497_ARATH Probable receptor-like protein kinase At1g49730	54.100%	Swiss-Prot	High
`Q9FIU5`	Arabidopsis thaliana	sp\|Q9FIU5\|CRLK1_ARATH Calcium/calmodulin-regulated receptor-like kinase 1	43.800%	Swiss-Prot	Low
`Q9FFW5`	Arabidopsis thaliana	sp\|Q9FFW5\|PERK8_ARATH Proline-rich receptor-like protein kinase PERK8	41.700%	Swiss-Prot	Low
`Q9LRY1`	Arabidopsis thaliana	sp\|Q9LRY1\|PBL25_ARATH Probable serine/threonine-protein kinase PBL25	39.200%	Swiss-Prot	Low
`Q0WRY5`	Arabidopsis thaliana	sp\|Q0WRY5\|PBL7_ARATH Probable serine/threonine-protein kinase PBL7	41.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card