TkA04G420670 | RubberDandelionOmics

Gene overview

TkA04G420670

Reference: TK1151 Chr: Chr04 Coordinates: 106000619-106001144 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

363 bp · TkA04G420670|TK1151|cDNA

ATGGAGAACATTATGGTGTATCTAGAAACAGGTTGTGGAAAGACCCACATTGTTGTTTTACTTATTTGTGAAATAAACCGCCAGATGAAGAAATCCCAAAAGGAAATATGCATTTTTCTTGCTCCCACTGTGGCTCTTGTTGAACAACAAGCAAAGGTTATAAAAGACTCTATAGATGTAGAAGTTGGAATCTATTGTGGGAGATCGATGGGTTTAAAGGGTCATCATGATTGGGAGACGGAATTGGAACAACACGAGGT...

CDS

Download CDS FASTA

363 bp · TkA04G420670|TK1151|CDS

ATGGAGAACATTATGGTGTATCTAGAAACAGGTTGTGGAAAGACCCACATTGTTGTTTTACTTATTTGTGAAATAAACCGCCAGATGAAGAAATCCCAAAAGGAAATATGCATTTTTCTTGCTCCCACTGTGGCTCTTGTTGAACAACAAGCAAAGGTTATAAAAGACTCTATAGATGTAGAAGTTGGAATCTATTGTGGGAGATCGATGGGTTTAAAGGGTCATCATGATTGGGAGACGGAATTGGAACAACACGAGGT...

Protein

Download Protein FASTA

120 aa · TkA04G420670|TK1151|PROTEIN

MENIMVYLETGCGKTHIVVLLICEINRQMKKSQKEICIFLAPTVALVEQQAKVIKDSIDVEVGIYCGRSMGLKGHHDWETELEQHEVFVMTSQILLHSLEREIIQLGIFSKHFVLTNNRV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G420670`
TK1151 ID	TkA04G420670
OH-1004 ID	LXL04_002782
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	85.800
Protein coverage (%)	TK1151 88.333 / OH-1004 6.471 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G420670

Location Chr04:106000619-106001144 (+)

Description Similar to DCL4: Dicer-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20320`	Ribonuclease (RNase) III involved in RNA-mediated post- transcriptional gene silencing (PTGS).	Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.2005 · DOI: 10.1016/j.cub.2005.07.024 DICER-LIKE 4 functions in trans-acting small interfering RNA biogenesis and vegetative phase change in Arabidopsis thaliana.2005 · DOI: 10.1073/pnas.0506426102 A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis.2005 · DOI: 10.1101/gad.1352605 DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal.2005 · DOI: 10.1038/ng1675 DRB4-dependent TAS3 trans-acting siRNAs control leaf morphology through AGO7.2006 · DOI: 10.1016/j.cub.2006.03.035 An antagonistic function for Arabidopsis DCL2 in development and a new function for DCL4 in generating viral siRNAs.2006 · DOI: 10.1038/sj.emboj.7601217 Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs.2007 · DOI: 10.1105/tpc.106.047449 Transitivity in Arabidopsis can be primed, requires the redundant action of the antiviral Dicer-like 4 and Dicer-like 2, and is compromised by viral-encoded suppressor proteins.2007 · DOI: 10.1261/rna.541307 A novel class of bacteria-induced small RNAs in Arabidopsis.2007 · DOI: 10.1101/gad.1595107 Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated by DCL1.2008 · DOI: 10.1073/pnas.0805760105

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0509300`	Involved in the RNA silencing pathway.	The small interfering RNA production pathway is required for shoot meristem initiation in rice.2007 · DOI: 10.1073/pnas.0704339104 Oryza sativa dicer-like4 reveals a key role for small interfering RNA silencing in plant development.2007 · DOI: 10.1105/tpc.107.052209

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002782 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006353 DNA-templated transcription termination Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0009616 RNAi-mediated antiviral immune response Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0010050 vegetative phase change Biological Process

GO:0010267 ta-siRNA processing Biological Process

GO:0010492 maintenance of shoot apical meristem identity Biological Process

GO:0010599 lsiRNA processing Biological Process

GO:0030422 siRNA processing Biological Process

GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0051214 RNAi-mediated antiviral immunity against RNA virus Biological Process

KEGG gene cross-reference

ath:AT3G03300

ath:AT5G20320

dosa:Os01g0909200

dosa:Os04g0509300

dosa:Os10g0485600

osa:4324864

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.655

Rank 1 · TkA04G420670 · TK1151

Cytoplasm0.382

Rank 2 · TkA04G420670 · TK1151

Mitochondrion0.038

Rank 3 · TkA04G420670 · TK1151

Cell membrane0.032

Rank 4 · TkA04G420670 · TK1151

Endoplasmic reticulum0.031

Rank 5 · TkA04G420670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270DEAD2-101 aa

PF04851ResIII3-100 aa

PF00910RNA_helicase4-43 aa

PF30694AAA_RNF213_35-33 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G420670	`PF00270`	DEAD	2	101	2.4e-12	47.6
TkA04G420670	`PF04851`	ResIII	3	100	4.4e-08	33.9
TkA04G420670	`PF00910`	RNA_helicase	4	43	0.24	12.6
TkA04G420670	`PF30694`	AAA_RNF213_3	5	33	0.06	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P84634`	Arabidopsis thaliana	sp\|P84634\|DCL4_ARATH Dicer-like protein 4	55.000%	Swiss-Prot	High
`A7LFZ6`	Oryza sativa subsp. japonica	sp\|A7LFZ6\|DCL4_ORYSJ Endoribonuclease Dicer homolog 4	51.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card