RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G406460
Reference: TK1151 Chr: Chr04 Coordinates: 102190934-102193132 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1001 bp · TkA04G406460|TK1151|cDNA

AGACTTTGCCCCCATCTCCCTTTTCCCCCTAATTGCATATATACTCCCCCATATCATAAGTACCATCACATCCTATCATTCCCCAAACCCCACTTCTCAGTTCACAGGAATATGAAGATCCAGTGCGATGTCTGTCACCAATCAGAGGCCGCCGTTTACTGCACCGCCGATGAAGCCTCCCTCTGCACCTCCTGCGACCACCGCGTCCACCATGCCAACAAACTCGCCAGCAAACACTCGCGTTTCTCCCTCATCAATCC...

CDS

Download CDS FASTA

696 bp · TkA04G406460|TK1151|CDS

AGACTTTGCCCCCATCTCCCTTTTCCCCCTAATTGCATATATACTCCCCCATATCATAAGTACCATCACATCCTATCATTCCCCAAACCCCACTTCTCAGTTCACAGGAATATGAAGATCCAGTGCGATGTCTGTCACCAATCAGAGGCCGCCGTTTACTGCACCGCCGATGAAGCCTCCCTCTGCACCTCCTGCGACCACCGCGTCCACCATGCCAACAAACTCGCCAGCAAACACTCGCGTTTCTCCCTCATCAATCC...

Protein

Download Protein FASTA

231 aa · TkA04G406460|TK1151|PROTEIN

RLCPHLPFPPNCIYTPPYHKYHHILSFPKPHFSVHRNMKIQCDVCHQSEAAVYCTADEASLCTSCDHRVHHANKLASKHSRFSLINPSFKDSPRCDICQERRAFLFCKEDRAILCRECDIPIHSANEHTQKHTRFLLTGVKLSPALSCYNDSSTHQTPSSSNTNGSVEIESSTRYGDAFNEQGVSFDYHTSCSLTQEEDALMEARNISEYLMETLPGWHVDEFLDPYGFSL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G406460
TK1151 IDTkA04G406460
OH-1004 IDLXL04_038212
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)97.400
Protein coverage (%)TK1151 83.550 / OH-1004 96.985
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G406460
LocationChr04:102190934-102193132 (-)
DescriptionSimilar to BBX21: B-box zinc finger protein 21
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g75540 Transcription activator that acts as a positive regulator of seedling photomorphogenesis.
SALT TOLERANCE HOMOLOG2, a B-box protein in Arabidopsis that activates transcription and positively regulates light-mediated development.2007 · DOI: 10.1105/tpc.107.054791
At4g39070 Acts as a positive regulator of seedling photomorphogenesis. No verified direct reference in this release
At1g06040 Acts as a negative regulator of seedling photomorphogenesis and light-regulated inhibition of hypocotyl elongation.
Nuclear localization and interaction with COP1 are required for STO/BBX24 function during photomorphogenesis.2011 · DOI: 10.1104/pp.111.180208
Arabidopsis STO/BBX24 negatively regulates UV-B signaling by interacting with COP1 and repressing HY5 transcriptional activity.2012 · DOI: 10.1038/cr.2012.34
The Arabidopsis B-BOX protein BBX25 interacts with HY5, negatively regulating BBX22 expression to suppress seedling photomorphogenesis.2013 · DOI: 10.1105/tpc.113.109751
At1g78600 Acts as a positive regulator of seedling photomorphogenesis and light-regulated inhibition of hypocotyl elongation, independently and in concert with HY5 and BBX21.
LZF1, a HY5-regulated transcriptional factor, functions in Arabidopsis de-etiolation.2008 · DOI: 10.1111/j.1365-313x.2008.03401.x
The common function of a novel subfamily of B-Box zinc finger proteins with reference to circadian-associated events in Arabidopsis thaliana.2008 · DOI: 10.1271/bbb.80041
LZF1/SALT TOLERANCE HOMOLOG3, an Arabidopsis B-box protein involved in light-dependent development and gene expression, undergoes COP1-mediated ubiquitination.2008 · DOI: 10.1105/tpc.108.061747
COP1-mediated degradation of BBX22/LZF1 optimizes seedling development in Arabidopsis.2011 · DOI: 10.1104/pp.111.175042
At2g31380 Acts as a negative regulator of seedling photomorphogenesis.
The Arabidopsis B-BOX protein BBX25 interacts with HY5, negatively regulating BBX22 expression to suppress seedling photomorphogenesis.2013 · DOI: 10.1105/tpc.113.109751

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_038212 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009416 response to light stimulus Biological Process
GO:0009640 photomorphogenesis Biological Process
GO:0009641 shade avoidance Biological Process
GO:0009658 chloroplast organization Biological Process
GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process
GO:0009741 response to brassinosteroid Biological Process
GO:0010100 negative regulation of photomorphogenesis Biological Process
GO:0010117 photoprotection Biological Process
GO:0010228 vegetative to reproductive phase transition of meristem Biological Process
GO:0015995 chlorophyll biosynthetic process Biological Process
KEGG gene cross-reference
ath:AT1G06040
ath:AT1G75540
ath:AT1G78600
ath:AT2G31380
ath:AT4G39070
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.742
Rank 1 · TkA04G406460 · TK1151
Cytoplasm0.369
Rank 2 · TkA04G406460 · TK1151
Cell membrane0.044
Rank 3 · TkA04G406460 · TK1151
Endoplasmic reticulum0.039
Rank 4 · TkA04G406460 · TK1151
Lysosome / Vacuole0.030
Rank 5 · TkA04G406460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00643zf-B_box19-26 aa
PF14537Cytochrom_c3_234-118 aa
PF21936Pcf11_C35-53 aa
PF11077DUF261636-86 aa
PF00643zf-B_box40-81 aa
PF16366CEBP_ZZ41-80 aa
PF10080FtrD-like41-71 aa
PF28084HVO_A055641-66 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G406460PF00643zf-B_box19261.3e-1145.2
TkA04G406460PF14537Cytochrom_c3_2341180.5211.5
TkA04G406460PF21936Pcf11_C35530.113.3
TkA04G406460PF11077DUF261636860.3611.4
TkA04G406460PF00643zf-B_box40811.3e-1145.2
TkA04G406460PF16366CEBP_ZZ41806.9e-0523.7
TkA04G406460PF10080FtrD-like41710.003318.2
TkA04G406460PF28084HVO_A055641665.17.8
TkA04G406460PF25993zf-B_box_ZFPL141678.07.3
TkA04G406460PF22586ANCHR-like_BBOX42790.001619.2
TkA04G406460PF13824zf-Mss5142710.1313.1
TkA04G406460PF00628PHD42715.87.7
TkA04G406460PF15257DUF459045746.07.6
TkA04G406460PF15257DUF459058866.07.6
TkA04G406460PF30478CGGBP1_N61751.010.0
TkA04G406460PF16366CEBP_ZZ851336.9e-0523.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LQZ7Arabidopsis thalianasp|Q9LQZ7|BBX21_ARATH B-box zinc finger protein 2152.700%Swiss-ProtHigh
Q0IGM7Arabidopsis thalianasp|Q0IGM7|BBX20_ARATH B-box zinc finger protein 2051.000%Swiss-ProtHigh
Q96288Arabidopsis thalianasp|Q96288|BBX24_ARATH B-box zinc finger protein 2461.000%Swiss-ProtLow
Q9SYM2Arabidopsis thalianasp|Q9SYM2|BBX22_ARATH B-box zinc finger protein 2257.100%Swiss-ProtLow
Q9SID1Arabidopsis thalianasp|Q9SID1|BBX25_ARATH B-box zinc finger protein 2556.200%Swiss-ProtLow

JBrowse

View in Genome Browser