TkA04G394230 | RubberDandelionOmics

Gene overview

TkA04G394230

Reference: TK1151 Chr: Chr04 Coordinates: 99128347-99129528 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

783 bp · TkA04G394230|TK1151|cDNA

ATGAACGAGTCTTTTATCATCGACTCAGACACACCATCGTGGCCGAGTTTGAAGGAGGTGGAGAAGATCATAGAGTATGAATTCAAAAACAAAGACTTGTTGAAAGAAGCTTTTACTCATAATTCTTACAAAGATGACACTACTTGTCCATCTTATGATCGACTTGAGTACCTTGGTGACTCGTTTTTGAACCTTATGATTGCTAAAGAACACTATTTCATGTACCCAAAGCTGACTTCTGGTGAGTTGACTCGGCTGCG...

CDS

Download CDS FASTA

783 bp · TkA04G394230|TK1151|CDS

ATGAACGAGTCTTTTATCATCGACTCAGACACACCATCGTGGCCGAGTTTGAAGGAGGTGGAGAAGATCATAGAGTATGAATTCAAAAACAAAGACTTGTTGAAAGAAGCTTTTACTCATAATTCTTACAAAGATGACACTACTTGTCCATCTTATGATCGACTTGAGTACCTTGGTGACTCGTTTTTGAACCTTATGATTGCTAAAGAACACTATTTCATGTACCCAAAGCTGACTTCTGGTGAGTTGACTCGGCTGCG...

Protein

Download Protein FASTA

260 aa · TkA04G394230|TK1151|PROTEIN

MNESFIIDSDTPSWPSLKEVEKIIEYEFKNKDLLKEAFTHNSYKDDTTCPSYDRLEYLGDSFLNLMIAKEHYFMYPKLTSGELTRLRAANIDTEALGRATFKHGLHRFLRHHDHLFDERIQELMEGIKEYPLHSTGLIHSPKIFADILESLVGAIYVDTNLSVDTTWEVVKNLLQPLVIPENLNLNPVTRLNEMCQKVGIKTEYKDLWVESGEIEIYVSDKLIGRGKNKNKKTIAKNKAAAQAYENLFKQPGLNDESTCF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G394230`
TK1151 ID	TkA04G394230
OH-1004 ID	LXL04_038131
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 96.538 / OH-1004 98.431 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G394230

Location Chr04:99128347-99129528 (-)

Description Similar to Os06g0358800: Ribonuclease 3-like protein 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20420`	Ribonuclease that cleaves double-stranded RNA (dsRNA).	Characterization of a ribonuclease III-like protein required for cleavage of the pre-rRNA in the 3'ETS in Arabidopsis.2008 · DOI: 10.1093/nar/gkm1130 An Arabidopsis RNase III-like protein, AtRTL2, cleaves double-stranded RNA in vitro.2011 · DOI: 10.1007/s10265-010-0382-x
`At1g01040`	Ribonuclease (RNase) III involved in RNA-mediated post- transcriptional gene silencing (PTGS).	Specific interactions between Dicer-like proteins and HYL1/DRB-family dsRNA-binding proteins in Arabidopsis thaliana.2005 · DOI: 10.1007/s11103-004-6853-5 Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.2005 · DOI: 10.1016/j.cub.2005.07.024 The interaction between DCL1 and HYL1 is important for efficient and precise processing of pri-miRNA in plant microRNA biogenesis.2006 · DOI: 10.1261/rna.2146906 A novel class of bacteria-induced small RNAs in Arabidopsis.2007 · DOI: 10.1101/gad.1595107 The RNA-binding proteins HYL1 and SE promote accurate in vitro processing of pri-miRNA by DCL1.2008 · DOI: 10.1073/pnas.0803356105 Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated by DCL1.2008 · DOI: 10.1073/pnas.0805760105

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0358800`	Cleaves double-stranded RNA (dsRNA).	No verified direct reference in this release
`Os03g0121800`	Involved in the RNA silencing pathway.	Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice.2005 · DOI: 10.1104/pp.105.063420 Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs).2008 · DOI: 10.1073/pnas.0708743105
`Os10g0485600`	Probably involved in the RNA silencing pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038131 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006396 RNA processing Biological Process

GO:0009616 RNAi-mediated antiviral immune response Biological Process

GO:0009880 embryonic pattern specification Biological Process

GO:0009908 flower development Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010267 ta-siRNA processing Biological Process

GO:0010599 lsiRNA processing Biological Process

GO:0030422 siRNA processing Biological Process

GO:0031053 primary miRNA processing Biological Process

GO:0035196 miRNA processing Biological Process

KEGG gene cross-reference

ath:AT1G01040

ath:AT3G20420

dosa:Os03g0121800

dosa:Os05g0271300

dosa:Os06g0358800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.622

Rank 1 · TkA04G394230 · TK1151

Nucleus0.522

Rank 2 · TkA04G394230 · TK1151

Mitochondrion0.054

Rank 3 · TkA04G394230 · TK1151

Cell membrane0.037

Rank 4 · TkA04G394230 · TK1151

Endoplasmic reticulum0.028

Rank 5 · TkA04G394230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14622Ribonucleas_3_330-163 aa

PF00636Ribonuclease_353-159 aa

PF11344DUF314695-115 aa

PF11212DUF2999114-163 aa

PF11212DUF2999181-201 aa

PF24799Paxt-1_C184-249 aa

PF00035dsrm187-247 aa

PF00636Ribonuclease_3215-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G394230	`PF14622`	Ribonucleas_3_3	30	163	2.8e-18	67.0
TkA04G394230	`PF00636`	Ribonuclease_3	53	159	8.9e-22	78.5
TkA04G394230	`PF11344`	DUF3146	95	115	0.31	11.5
TkA04G394230	`PF11212`	DUF2999	114	163	0.11	13.4
TkA04G394230	`PF11212`	DUF2999	181	201	0.11	13.4
TkA04G394230	`PF24799`	Paxt-1_C	184	249	0.094	13.0
TkA04G394230	`PF00035`	dsrm	187	247	1.4e-07	32.7
TkA04G394230	`PF00636`	Ribonuclease_3	215	241	8.9e-22	78.5
TkA04G394230	`PF03368`	Dicer_dimer	226	255	0.21	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LTQ0`	Arabidopsis thaliana	sp\|Q9LTQ0\|RTL2_ARATH Ribonuclease 3-like protein 2	40.800%	Swiss-Prot	Medium
`Q9SP32`	Arabidopsis thaliana	sp\|Q9SP32\|DCL1_ARATH Endoribonuclease Dicer homolog 1	35.700%	Swiss-Prot	Medium
`Q69KJ0`	Oryza sativa subsp. japonica	sp\|Q69KJ0\|RTL3_ORYSJ Ribonuclease 3-like protein 3	42.300%	Swiss-Prot	Medium
`Q8LMR2`	Oryza sativa subsp. japonica	sp\|Q8LMR2\|DCL1_ORYSJ Endoribonuclease Dicer homolog 1	36.700%	Swiss-Prot	Medium
`Q7XD96`	Oryza sativa subsp. japonica	sp\|Q7XD96\|DCL3B_ORYSJ Endoribonuclease Dicer homolog 3b	34.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card