TkA04G392450 | RubberDandelionOmics

Gene overview

TkA04G392450

Reference: TK1151 Chr: Chr04 Coordinates: 98674259-98676760 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1795 bp · TkA04G392450|TK1151|cDNA

TGAACTTAAGTCATCCTTTTATTTTCATAACCGTAATCAATTAAAATTTGACACTAAAATAACCTTTCTCGATATACAATAAAAACACCCGGGATAACGAGAAGCCATCCCTCTCCGTAAAGTCTTTCAACCCCAACTTGCCGCCGCTTCGATATTGGCTTCCCTGCAAACCCTACCAAAGGTCTATCAACACCGCTGTCGACGGCGGCTCCGATAACTCAATAGCCTCACCTCACACCCCATTTTTTCTCGCAACAAGT...

CDS

Download CDS FASTA

1281 bp · TkA04G392450|TK1151|CDS

ATGGCGTCAGGCACGGCTACTTCTGACGTCACTGATGGACCAGTCCTCACTCTTATCAACAAGCGCATCCGAAACCTAAGGAAAAAGCTCAACCGAATCGCGCAGCTCGAAGATTCCATCGCTCAAGGCAAATCCATTATTAAGAACAAGGAACAGGAAGAGCTTCTCAAATCGAAGCCTTCGATCATCGCCGCGGTCGACGAGTTAGAGAAGTTTCGTCAGCCCTTATCCGTCGCCGTTGATGAAGAAATCAGTCTCGC...

Protein

Download Protein FASTA

426 aa · TkA04G392450|TK1151|PROTEIN

MASGTATSDVTDGPVLTLINKRIRNLRKKLNRIAQLEDSIAQGKSIIKNKEQEELLKSKPSIIAAVDELEKFRQPLSVAVDEEISLAIQRRPVTASEDNDNDDDSSKTQTLDKEQQETEPPALAVDDLLSLIYLGSMFDVKSQNEFNSIMLTRTHERNCCLTYDYVTDDDAAVMLGERDLDLISMMGSLLISRPADSSLSHQNALQRCIEHAKLWLSKSEQQIDSNSNVTYANLREKLTKIMGSDYLKITPEMKAPADVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G392450`
TK1151 ID	TkA04G392450
OH-1004 ID	LXL04_016929
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	55.100
Protein coverage (%)	TK1151 64.319 / OH-1004 34.622 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G392450`
Location	Chr04:98674259-98676760 (-)
Description	Similar to At3g06240: F-box/kelch-repeat protein At3g06240
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_016929` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0008284 positive regulation of cell population proliferation Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031348 negative regulation of defense response Biological Process GO:0042177 negative regulation of protein catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0009506 plasmodesma Cellular Component
KEGG gene cross-reference	ath:AT3G06240 ath:AT3G07870 ath:AT4G12560 ath:AT4G21240 ath:AT5G18160 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.673

Rank 1 · TkA04G392450 · TK1151

Cytoplasm0.406

Rank 2 · TkA04G392450 · TK1151

Cell membrane0.031

Rank 3 · TkA04G392450 · TK1151

Endoplasmic reticulum0.030

Rank 4 · TkA04G392450 · TK1151

Mitochondrion0.024

Rank 5 · TkA04G392450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06295ZapG-like69-69 aa

PF20644Rrn7_cyclin_N97-137 aa

PF18293Caprin-1_dimer164-247 aa

PF06295ZapG-like186-260 aa

PF20644Rrn7_cyclin_N291-311 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G392450	`PF06295`	ZapG-like	69	69	1.8	9.3
TkA04G392450	`PF20644`	Rrn7_cyclin_N	97	137	5.2	7.9
TkA04G392450	`PF18293`	Caprin-1_dimer	164	247	0.0023	19.1
TkA04G392450	`PF06295`	ZapG-like	186	260	1.8	9.3
TkA04G392450	`PF20644`	Rrn7_cyclin_N	291	311	5.2	7.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card