TkA04G383670 | RubberDandelionOmics

Gene overview

TkA04G383670

Reference: TK1151 Chr: Chr04 Coordinates: 96561434-96564990 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2434 bp · TkA04G383670|TK1151|cDNA

ATGGGTATATCCCCTGCAAGGTGTAGATACCAAGTTCTGTCAACAAAAGTTGAAATCCGGCTTGCAAAAGCTGAACCTATTCACTGGACATCTCTTGAATATGGTCAAAACAATGTGGTTGCAGTAAGGAGTAATGTCCCTACAGCTTCATCCACCAACAAAGAAGACACAAAATTTAAAAGGTTTTGGATTCAAAGTAATCCAAGAAAATGTTCAAGTGGTGAAGATGTTCAAGTAGTGGAGAATGGAGATGTCGAGAT...

CDS

Download CDS FASTA

2421 bp · TkA04G383670|TK1151|CDS

ATGGGTATATCCCCTGCAAGGTGTAGATACCAAGTTCTGTCAACAAAAGTTGAAATCCGGCTTGCAAAAGCTGAACCTATTCACTGGACATCTCTTGAATATGGTCAAAACAATGTGGTTGCAGTAAGGAGTAATGTCCCTACAGCTTCATCCACCAACAAAGAAGACACAAAATTTAAAAGGTTTTGGATTCAAAGTAATCCAAGAAAATGTTCAAGTGGTGAAGATGTTCAAGTAGTGGAGAATGGAGATGTCGAGAT...

Protein

Download Protein FASTA

806 aa · TkA04G383670|TK1151|PROTEIN

MGISPARCRYQVLSTKVEIRLAKAEPIHWTSLEYGQNNVVAVRSNVPTASSTNKEDTKFKRFWIQSNPRKCSSGEDVQVVENGDVEMSKFKDGNHMFYYGSVTTDSLRNHCYGFYNGKIATDFTMEACQRILLRNTLATESMKKEVFNGKTEDRKARLPLRGTTVFSRVEKLNITFGKVICKKKGKRKRKGLLLNIKGKSKDGKLVREDMVAMGIRPELAPIENPGKHTYLPAACYTMSKDEKTRFCKCLHGVKVPSGYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G383670`
TK1151 ID	TkA04G383670
OH-1004 ID	LXL04_009153
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	58.700
Protein coverage (%)	TK1151 79.529 / OH-1004 60.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G383670

Location Chr04:96561434-96564990 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g11260`	Involved in plant innate immunity.	Regulatory role of SGT1 in early R gene-mediated plant defenses.2002 · DOI: 10.1126/science.1067747 Arabidopsis SGT1b is required for defense signaling conferred by several downy mildew resistance genes.2002 · DOI: 10.1105/tpc.001123 Arabidopsis SGT1b is required for SCF(TIR1)-mediated auxin response.2003 · DOI: 10.1105/tpc.010884 Antagonistic control of disease resistance protein stability in the plant immune system.2005 · DOI: 10.1126/science.1109977 Role of SGT1 in resistance protein accumulation in plant immunity.2006 · DOI: 10.1038/sj.emboj.7601084 Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses.2007 · DOI: 10.1105/tpc.107.051896 Enhanced defense responses in Arabidopsis induced by the cell wall protein fractions from Pythium oligandrum require SGT1, RAR1, NPR1 and JAR1.2009 · DOI: 10.1093/pcp/pcp044 SGT1 contributes to coronatine signaling and Pseudomonas syringae pv. tomato disease symptom development in tomato and Arabidopsis.2011 · DOI: 10.1111/j.1469-8137.2010.03470.x
`At4g23570`	Functions in R gene-mediated resistance, but participates in a lower extent than SGT1B to RPP5-mediated resistance.	Role of SGT1 in resistance protein accumulation in plant immunity.2006 · DOI: 10.1038/sj.emboj.7601084

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0624500`	May participate in basal resistance to bacterial blight in rice.	OsRAR1 and OsSGT1 physically interact and function in rice basal disease resistance.2008 · DOI: 10.1094/mpmi-21-3-0294

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009153 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.886

Rank 1 · TkA04G383670 · TK1151

Cytoplasm0.184

Rank 2 · TkA04G383670 · TK1151

Mitochondrion0.025

Rank 3 · TkA04G383670 · TK1151

Cell membrane0.022

Rank 4 · TkA04G383670 · TK1151

Extracellular0.015

Rank 5 · TkA04G383670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13960DUF4218316-421 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G383670	`PF13960`	DUF4218	316	421	1.5e-35	122.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUT5`	Arabidopsis thaliana	sp\|Q9SUT5\|SGT1B_ARATH Protein SGT1 homolog B	42.200%	Swiss-Prot	Low
`Q9SUR9`	Arabidopsis thaliana	sp\|Q9SUR9\|SGT1A_ARATH Protein SGT1 homolog A	35.900%	Swiss-Prot	Low
`Q0JL44`	Oryza sativa subsp. japonica	sp\|Q0JL44\|SGT1_ORYSJ Protein SGT1 homolog	39.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card