TkA04G367750 | RubberDandelionOmics

Gene overview

TkA04G367750

Reference: TK1151 Chr: Chr04 Coordinates: 92431903-92434849 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1557 bp · TkA04G367750|TK1151|cDNA

CTAGGGTTTATGAATAACCTGTGAGAGTTAAATCTAATTAACGGTGCAGTAGTCGTCGGCCACCGGAGCATGGAGGGTTTAGCATCATCGACGGCTTGTTTCGATTTCCATTCATTGCTTTACAGCAGCTACTCACATAACACCGGCTCCAGATCTAAATTCCGTACATTGATTTCCATTCCGTCATCCCCAATCGACAGTCGCATAGCTACTAGTTTTCATGTTCGATCGCGGCCGATGAGTCATCTACAGTCTGCAAC...

CDS

Download CDS FASTA

1227 bp · TkA04G367750|TK1151|CDS

ATGGAGGGTTTAGCATCATCGACGGCTTGTTTCGATTTCCATTCATTGCTTTACAGCAGCTACTCACATAACACCGGCTCCAGATCTAAATTCCGTACATTGATTTCCATTCCGTCATCCCCAATCGACAGTCGCATAGCTACTAGTTTTCATGTTCGATCGCGGCCGATGAGTCATCTACAGTCTGCAACGCTGGTTGGGTATTCAGTCGGAGCTCCATCGAGTGAATCGTTAGTTGACGAGCTCAAAATCAAAGAGTG...

Protein

Download Protein FASTA

408 aa · TkA04G367750|TK1151|PROTEIN

MEGLASSTACFDFHSLLYSSYSHNTGSRSKFRTLISIPSSPIDSRIATSFHVRSRPMSHLQSATLVGYSVGAPSSESLVDELKIKEWEIGALRDELAATQGIRIRRRPPTAPPLDYVGPFEVNLQNEETTPRNILEEIVWNKDVEVTQMKDKHPVDSLKKALESASHPPRDFVGALKASYLRTGFPGLIAEVKKASPSRGVLREDFDPVEVAKAYEKGGAACLSVLTDAKYFQGSFENLEAIRKAGVQCPLLCKEFIVDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G367750`
TK1151 ID	TkA04G367750
OH-1004 ID	LXL04_037962
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G367750

Location Chr04:92431903-92434849 (-)

Description Similar to IGPS: Indole-3-glycerol phosphate synthase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g04400`	Indole-3-glycerol phosphate synthase required for tryptophan biosynthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037962 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000162 L-tryptophan biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004425 indole-3-glycerol-phosphate synthase activity Molecular Function

GO:0004640 phosphoribosylanthranilate isomerase activity Molecular Function

GO:0005507 copper ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G04400

cyp:PCC8801_3489

cyt:cce_2305

mar:MAE_45030

syn:slr0546

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.982

Rank 1 · TkA04G367750 · TK1151

Mitochondrion0.027

Rank 2 · TkA04G367750 · TK1151

Cytoplasm0.021

Rank 3 · TkA04G367750 · TK1151

Nucleus0.019

Rank 4 · TkA04G367750 · TK1151

Peroxisome0.017

Rank 5 · TkA04G367750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21928XLF_CC76-99 aa

PF00218IGPS135-400 aa

PF00977His_biosynth205-245 aa

PF05690ThiG238-290 aa

PF00977His_biosynth350-403 aa

PF05690ThiG353-395 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G367750	`PF21928`	XLF_CC	76	99	0.19	12.3
TkA04G367750	`PF00218`	IGPS	135	400	9.8e-76	255.0
TkA04G367750	`PF00977`	His_biosynth	205	245	0.027	14.7
TkA04G367750	`PF05690`	ThiG	238	290	0.048	13.7
TkA04G367750	`PF00977`	His_biosynth	350	403	0.027	14.7
TkA04G367750	`PF05690`	ThiG	353	395	0.048	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P49572`	Arabidopsis thaliana	sp\|P49572\|TRPC_ARATH Indole-3-glycerol phosphate synthase, chloroplastic	66.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card