TkA04G366360 | RubberDandelionOmics

Gene overview

TkA04G366360

Reference: TK1151 Chr: Chr04 Coordinates: 92072723-92074840 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1371 bp · TkA04G366360|TK1151|cDNA

ATGATCTATTGGGAGAAAAAAATGGCAGCGTCCACCAAAGTTATCATCACATTAACCACACTTTCACTTCTTCTTTTTGTACTTTATGTATCTCCAATAAATCAAACCCAAAACACCCATTCTACTTTGACATCATCAGCATCAACCTTCAGACGTCTGCAAGATGATGCTAAATTAAAGATCAAAGACAACGATATTAAATTGGCAAGAGTCGAACAACAGTTGACTGAGGCAAGACGCAATATTCGCCAAGCTATTGT...

CDS

Download CDS FASTA

1371 bp · TkA04G366360|TK1151|CDS

ATGATCTATTGGGAGAAAAAAATGGCAGCGTCCACCAAAGTTATCATCACATTAACCACACTTTCACTTCTTCTTTTTGTACTTTATGTATCTCCAATAAATCAAACCCAAAACACCCATTCTACTTTGACATCATCAGCATCAACCTTCAGACGTCTGCAAGATGATGCTAAATTAAAGATCAAAGACAACGATATTAAATTGGCAAGAGTCGAACAACAGTTGACTGAGGCAAGACGCAATATTCGCCAAGCTATTGT...

Protein

Download Protein FASTA

456 aa · TkA04G366360|TK1151|PROTEIN

MIYWEKKMAASTKVIITLTTLSLLLFVLYVSPINQTQNTHSTLTSSASTFRRLQDDAKLKIKDNDIKLARVEQQLTEARRNIRQAIVEKSHASSRKDGSFFPKGPVYKNPFAFFQSHTEMMKTFKIWTYKEGDLPLMHYGPMKLVYCIEGDFIEEMERKGNPIVANNPDEAHAFFIPISVTNMVHYLYTPDEAYNIRERMQAILEDYIKVIAERYPYWNRSKGADHFYVSCHDWGPIVSKGNPQLFENFIRVLCNANTSE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G366360`
TK1151 ID	TkA04G366360
OH-1004 ID	LXL04_002735
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.100
Protein coverage (%)	TK1151 73.026 / OH-1004 32.859 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G366360

Location Chr04:92072723-92074840 (-)

Description Similar to At5g35200: Putative clathrin assembly protein At5g35200

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g42180`	May be involved in cell wall biosynthesis.	No verified direct reference in this release
`At5g20260`	May be involved in cell wall biosynthesis.	No verified direct reference in this release
`UniProt: Q9LFP3`	May be involved in cell wall biosynthesis.	No verified direct reference in this release
`At5g33290`	Involved in pectin biosynthesis.	Identification of a xylogalacturonan xylosyltransferase involved in pectin biosynthesis in Arabidopsis.2008 · DOI: 10.1105/tpc.107.050906
`At5g03795`	May be involved in cell wall biosynthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002735 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006900 vesicle budding from membrane Biological Process

GO:0048268 clathrin coat assembly Biological Process

GO:0072583 clathrin-dependent endocytosis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005905 clathrin-coated pit Cellular Component

GO:0009536 plastid Cellular Component

GO:0030136 clathrin-coated vesicle Cellular Component

KEGG gene cross-reference

ath:AT1G14910

ath:AT2G01600

ath:AT4G25940

ath:AT5G35200

ath:AT5G57200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.768

Rank 1 · TkA04G366360 · TK1151

Endoplasmic reticulum0.089

Rank 2 · TkA04G366360 · TK1151

Cell membrane0.059

Rank 3 · TkA04G366360 · TK1151

Cytoplasm0.045

Rank 4 · TkA04G366360 · TK1151

Extracellular0.039

Rank 5 · TkA04G366360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13623SurA_N_210-91 aa

PF00534Glycos_transf_126-74 aa

PF03016Exostosin_GT47143-406 aa

PF00534Glycos_transf_1304-376 aa

PF24785RXYLT1_C333-370 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G366360	`PF13623`	SurA_N_2	10	91	0.089	13.4
TkA04G366360	`PF00534`	Glycos_transf_1	26	74	0.015	15.5
TkA04G366360	`PF03016`	Exostosin_GT47	143	406	3.5e-52	178.3
TkA04G366360	`PF00534`	Glycos_transf_1	304	376	0.015	15.5
TkA04G366360	`PF24785`	RXYLT1_C	333	370	0.012	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3EAR7`	Arabidopsis thaliana	sp\|Q3EAR7\|GLYT2_ARATH Probable glycosyltransferase At3g42180	52.800%	Swiss-Prot	High
`Q3E9A4`	Arabidopsis thaliana	sp\|Q3E9A4\|GLYT5_ARATH Probable glycosyltransferase At5g20260	51.000%	Swiss-Prot	High
`Q9LFP3`	Arabidopsis thaliana	sp\|Q9LFP3\|GLYT4_ARATH Probable glycosyltransferase At5g11130	48.900%	Swiss-Prot	Medium
`Q94AA9`	Arabidopsis thaliana	sp\|Q94AA9\|XGD1_ARATH Xylogalacturonan beta-1,3-xylosyltransferase	50.300%	Swiss-Prot	High
`Q9FFN2`	Arabidopsis thaliana	sp\|Q9FFN2\|GLYT3_ARATH Probable glycosyltransferase At5g03795	49.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card