TkA04G365250 | RubberDandelionOmics

Gene overview

TkA04G365250

Reference: TK1151 Chr: Chr04 Coordinates: 91802133-91804620 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

708 bp · TkA04G365250|TK1151|cDNA

ATGCTTGGTTATCAAAGACGAAAAGGAGCACAAGGTGCACCTGCACGAGCGGTTAGAGATGTTGTGACAAGAGACGTGTTATACCAAGTACTCCAAGCGGGAGTGCTGGTTGTCCAAGTCCCGACCTCAGTGCGAAGCTCCGACGATCTCGTTTCGTTCGTCGCCGGAAGAGAAGCCCAAGAAGCTGCGTTTCCTTCTTCGTTGGTGCTCGATGGGAAAGAAACCGAGAGGAAGAAGGCGACGGGAATAGAAAGCTGTCG...

CDS

Download CDS FASTA

708 bp · TkA04G365250|TK1151|CDS

ATGCTTGGTTATCAAAGACGAAAAGGAGCACAAGGTGCACCTGCACGAGCGGTTAGAGATGTTGTGACAAGAGACGTGTTATACCAAGTACTCCAAGCGGGAGTGCTGGTTGTCCAAGTCCCGACCTCAGTGCGAAGCTCCGACGATCTCGTTTCGTTCGTCGCCGGAAGAGAAGCCCAAGAAGCTGCGTTTCCTTCTTCGTTGGTGCTCGATGGGAAAGAAACCGAGAGGAAGAAGGCGACGGGAATAGAAAGCTGTCG...

Protein

Download Protein FASTA

235 aa · TkA04G365250|TK1151|PROTEIN

MLGYQRRKGAQGAPARAVRDVVTRDVLYQVLQAGVLVVQVPTSVRSSDDLVSFVAGREAQEAAFPSSLVLDGKETERKKATGIESCRRDFAGFAFSVNEAAGGAAVTYSGQISGSHGGCHAGCRHWPTTTTTNLRFSSWKPITDGRLGTSSIRSGLLAPVHNFATDDTRGIFLWWFFLLMTGISMIIFLPDEAAGIEPAEVAPGASACYLRIAPWISSEMFDASWGFFGDREVTG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G365250`
TK1151 ID	TkA04G365250
OH-1004 ID	LXL04_040110
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 17.447 / OH-1004 5.474 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G365250

Location Chr04:91802133-91804620 (-)

Description Similar to Probable cytochrome c biosynthesis protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`AtMg00960`	Forms a complex with CCMFC, CCMFN1 and CCMH that performs the assembly of heme with c-type apocytochromes in mitochondria.	No verified direct reference in this release
`UniProt: P29388`	Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed to belong to the minimal assembly required for catalysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_040110 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0017004 cytochrome complex assembly Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0015232 heme transmembrane transporter activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.326

Rank 1 · TkA04G365250 · TK1151

Nucleus0.262

Rank 2 · TkA04G365250 · TK1151

Mitochondrion0.206

Rank 3 · TkA04G365250 · TK1151

Cell membrane0.194

Rank 4 · TkA04G365250 · TK1151

Endoplasmic reticulum0.103

Rank 5 · TkA04G365250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q33884`	Arabidopsis thaliana	sp\|Q33884\|CCMF2_ARATH Cytochrome c biogenesis CcmF N-terminal-like mitochondrial protein 2 (Fragment)	90.500%	Swiss-Prot	Low
`P29388`	Arabidopsis thaliana	sp\|P29388\|NU5M_ARATH NADH-ubiquinone oxidoreductase chain 5	90.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card