TkA04G362430 | RubberDandelionOmics

Gene overview

TkA04G362430

Reference: TK1151 Chr: Chr04 Coordinates: 91223355-91223876 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

339 bp · TkA04G362430|TK1151|cDNA

ATGACTGGTGGTTCAAAGCGTGAAGCTTTGATTAAATTGCAATTAGAGGGTACATGGTTATTGGAAACATTATTTGCGATGCTTATTGAGATTACTGAAAGGGTGATGGCACACTTTGACAGGAAAGATATTTTGATCGTTGGTGGTGTTGGGTGTAATGATTTGTTGCAGGAGATGATGAGAGTTATGTATGGTGAAAGAGGCGGGAATTTGTTTGCAACTACCGATCGGTATTGTGTTGATAATGGGGCGATGATTGC...

CDS

Download CDS FASTA

339 bp · TkA04G362430|TK1151|CDS

ATGACTGGTGGTTCAAAGCGTGAAGCTTTGATTAAATTGCAATTAGAGGGTACATGGTTATTGGAAACATTATTTGCGATGCTTATTGAGATTACTGAAAGGGTGATGGCACACTTTGACAGGAAAGATATTTTGATCGTTGGTGGTGTTGGGTGTAATGATTTGTTGCAGGAGATGATGAGAGTTATGTATGGTGAAAGAGGCGGGAATTTGTTTGCAACTACCGATCGGTATTGTGTTGATAATGGGGCGATGATTGC...

Protein

Download Protein FASTA

112 aa · TkA04G362430|TK1151|PROTEIN

MTGGSKREALIKLQLEGTWLLETLFAMLIEITERVMAHFDRKDILIVGGVGCNDLLQEMMRVMYGERGGNLFATTDRYCVDNGAMIAYMGLLAFAHERVTPFEESFLLVLEV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G362430`
TK1151 ID	TkA04G362430
OH-1004 ID	LXL04_026421
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	83.700
Protein coverage (%)	TK1151 76.786 / OH-1004 24.432 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G362430`
Location	Chr04:91223355-91223876 (+)
Description	Similar to osgep: Probable tRNA N6-adenosine threonylcarbamoyltransferase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_026421` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002949 tRNA threonylcarbamoyladenosine modification Biological Process GO:0006400 tRNA modification Biological Process GO:0000408 EKC/KEOPS complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0046872 metal ion binding Molecular Function GO:0061711 tRNA N(6)-L-threonylcarbamoyladenine synthase activity Molecular Function
KEGG gene cross-reference	bta:507512 mmu:66246 nve:5502327 rno:290028 xla:380480 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.623

Rank 1 · TkA04G362430 · TK1151

Nucleus0.249

Rank 2 · TkA04G362430 · TK1151

Extracellular0.086

Rank 3 · TkA04G362430 · TK1151

Mitochondrion0.074

Rank 4 · TkA04G362430 · TK1151

Peroxisome0.070

Rank 5 · TkA04G362430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00814TsaD21-88 aa

PF22521HypF_C_221-83 aa

PF26175HTH_FAR140-69 aa

PF24145K1-lyase_N62-87 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G362430	`PF00814`	TsaD	21	88	4.1e-13	50.4
TkA04G362430	`PF22521`	HypF_C_2	21	83	0.0021	18.6
TkA04G362430	`PF26175`	HTH_FAR1	40	69	0.25	11.9
TkA04G362430	`PF24145`	K1-lyase_N	62	87	0.094	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card