TkA04G333650 | RubberDandelionOmics

Gene overview

TkA04G333650

Reference: TK1151 Chr: Chr04 Coordinates: 84225986-84227587 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1350 bp · TkA04G333650|TK1151|cDNA

ATGCAAACCAGAATTTGGTCCCTGAAATGTCTTTTCTGTGGAAATCTTCGAGTACTTTACAAACCCAGAGCTCAAACTCTCATCCAATTCAAGCATATTGCATCTCTGATCCTCAATAAGCATGAATCATCATCAAATTTTCGAACTTTTCACAACGAAAGTCATGAACATCCAGAGTCTTGTAGCGAAGGAAATCACGGATTTCTCCCATCGCCGGTACCAAGCAAGGATGAATCCTCCGCCATGGATAGCAAAGCCCT...

CDS

Download CDS FASTA

1350 bp · TkA04G333650|TK1151|CDS

ATGCAAACCAGAATTTGGTCCCTGAAATGTCTTTTCTGTGGAAATCTTCGAGTACTTTACAAACCCAGAGCTCAAACTCTCATCCAATTCAAGCATATTGCATCTCTGATCCTCAATAAGCATGAATCATCATCAAATTTTCGAACTTTTCACAACGAAAGTCATGAACATCCAGAGTCTTGTAGCGAAGGAAATCACGGATTTCTCCCATCGCCGGTACCAAGCAAGGATGAATCCTCCGCCATGGATAGCAAAGCCCT...

Protein

Download Protein FASTA

449 aa · TkA04G333650|TK1151|PROTEIN

MQTRIWSLKCLFCGNLRVLYKPRAQTLIQFKHIASLILNKHESSSNFRTFHNESHEHPESCSEGNHGFLPSPVPSKDESSAMDSKALEVQALLKQINGHHEIEQALTQLGLSVNEDLVLNILRRHRSDWKSAYLFFTWVSNSSGYSPGTGSYNEILDILGRFKRFTEVSQLLDEMSNKNNNLINERTYGVVVNRYAAAHKIEDAIDFFYKRKQFGLKLDLIAFQTLLLSLCRYKHVEAAEFLFHSKKHEFPHTIKTMNII...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G333650`
TK1151 ID	TkA04G333650
OH-1004 ID	LXL04_039545
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	83.400
Protein coverage (%)	TK1151 99.109 / OH-1004 99.811 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G333650

Location Chr04:84225986-84227587 (-)

Description Similar to At3g15200: Putative pentatricopeptide repeat-containing protein At3g15200

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15200`	Putative pentatricopeptide repeat-containing protein At3g15200.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039545 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G80550

ath:AT3G15200

ath:AT3G62470

ath:AT5G15010

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.859

Rank 1 · TkA04G333650 · TK1151

Nucleus0.065

Rank 2 · TkA04G333650 · TK1151

Plastid0.064

Rank 3 · TkA04G333650 · TK1151

Cytoplasm0.033

Rank 4 · TkA04G333650 · TK1151

Cell membrane0.010

Rank 5 · TkA04G333650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28774DUF845789-107 aa

PF29768UU051_C93-124 aa

PF23276TPR_24128-208 aa

PF12854PPR_1144-176 aa

PF13812PPR_3146-160 aa

PF13041PPR_2147-195 aa

PF19189Mtf2149-177 aa

PF01535PPR151-178 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G333650	`PF28774`	DUF8457	89	107	0.13	13.3
TkA04G333650	`PF29768`	UU051_C	93	124	0.03	14.9
TkA04G333650	`PF23276`	TPR_24	128	208	0.0011	19.6
TkA04G333650	`PF12854`	PPR_1	144	176	6.1e-16	58.6
TkA04G333650	`PF13812`	PPR_3	146	160	9.9e-08	32.7
TkA04G333650	`PF13041`	PPR_2	147	195	2.4e-31	108.3
TkA04G333650	`PF19189`	Mtf2	149	177	0.13	12.7
TkA04G333650	`PF01535`	PPR	151	178	1.3e-19	69.6
TkA04G333650	`PF29070`	MSC6_N	151	306	4e-15	56.5
TkA04G333650	`PF28774`	DUF8457	151	181	0.13	13.3
TkA04G333650	`PF15571`	Imm44	161	201	0.94	10.2
TkA04G333650	`PF17177`	PPR_long	168	236	7.2e-06	26.2
TkA04G333650	`PF12854`	PPR_1	184	208	6.1e-16	58.6
TkA04G333650	`PF13041`	PPR_2	185	232	2.4e-31	108.3
TkA04G333650	`PF01535`	PPR	187	210	1.3e-19	69.6
TkA04G333650	`PF15571`	Imm44	197	247	0.94	10.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LIL5`	Arabidopsis thaliana	sp\|Q9LIL5\|PP233_ARATH Putative pentatricopeptide repeat-containing protein At3g15200	48.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card