TkA04G322400 | RubberDandelionOmics

Gene overview

TkA04G322400

Reference: TK1151 Chr: Chr04 Coordinates: 81424941-81426378 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1149 bp · TkA04G322400|TK1151|cDNA

ATGTTCCCATCTATCTCTCTGAAACCACCATTTTCAGACATGCTTTCAAGAGTTAATATTGTCGTTTGGATGGATGATGAGAGAGGGAATCACTCAAACAACAGAACCGAGCAAAATCATGAACTCAATTCCATTTCTACATTCAAATCAATGCTAGAAGTTGAAGAAGAAGAAAACAACAACTGGTTTTTACAGCAGCAGGGGAATCTTCTTTTGCATCCTGTTGATTCTTCATCCTTGTGTTCGCCGTCTTTGGCGTT...

CDS

Download CDS FASTA

1149 bp · TkA04G322400|TK1151|CDS

ATGTTCCCATCTATCTCTCTGAAACCACCATTTTCAGACATGCTTTCAAGAGTTAATATTGTCGTTTGGATGGATGATGAGAGAGGGAATCACTCAAACAACAGAACCGAGCAAAATCATGAACTCAATTCCATTTCTACATTCAAATCAATGCTAGAAGTTGAAGAAGAAGAAAACAACAACTGGTTTTTACAGCAGCAGGGGAATCTTCTTTTGCATCCTGTTGATTCTTCATCCTTGTGTTCGCCGTCTTTGGCGTT...

Protein

Download Protein FASTA

382 aa · TkA04G322400|TK1151|PROTEIN

MFPSISLKPPFSDMLSRVNIVVWMDDERGNHSNNRTEQNHELNSISTFKSMLEVEEEENNNWFLQQQGNLLLHPVDSSSLCSPSLAFQNHFFLPPKPSLSLILNPNPLDETFDLGCGNGFLGMSRGFCDLGAQTQMGVSNLSSDPQFSTTHLLQLAVNGFGSADFISKTSCLRRNLSDINTAGGVDGGGGDGVNEKKWKSCSGSWDDVDNLSLDGSGLNYDSNDFTVNTTTNFEENGIKINGGNSSNANSIVTGAGRSNQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G322400`
TK1151 ID	TkA04G322400
OH-1004 ID	LXL04_037548
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.200
Protein coverage (%)	TK1151 64.660 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G322400

Location Chr04:81424941-81426378 (+)

Description Similar to TK1A: Thymidine kinase a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07800`	Part of the salvage pathway for purine and pyrimidine deoxyribonucleotide synthesis.	Two thymidine kinases and one multisubstrate deoxyribonucleoside kinase salvage DNA precursors in Arabidopsis thaliana.2012 · DOI: 10.1111/j.1742-4658.2012.08747.x Arabidopsis thaliana thymidine kinase 1a is ubiquitously expressed during development and contributes to confer tolerance to genotoxic stress.2015 · DOI: 10.1007/s11103-014-0277-7
`At5g23070`	Part of the salvage pathway for purine and pyrimidine deoxyribonucleotide synthesis.	Two thymidine kinases and one multisubstrate deoxyribonucleoside kinase salvage DNA precursors in Arabidopsis thaliana.2012 · DOI: 10.1111/j.1742-4658.2012.08747.x
`At3g26744`	Transcriptional activator that regulates the cold-induced transcription of CBF/DREB1 genes.	SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048397 SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848
`At1g12860`	Mediates stomatal differentiation in the epidermis probably by controlling successive roles of SPCH, MUTE, and FAMA.	SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0113100`	Thymidine kinase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037548 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006302 double-strand break repair Biological Process

GO:0006950 response to stress Biological Process

GO:0009409 response to cold Biological Process

GO:0010225 response to UV-C Biological Process

GO:0046104 thymidine metabolic process Biological Process

GO:0071897 DNA biosynthetic process Biological Process

GO:0090351 seedling development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004797 thymidine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT3G07800

ath:AT5G23070

vg:1486465

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · TkA04G322400 · TK1151

Cytoplasm0.094

Rank 2 · TkA04G322400 · TK1151

Cell membrane0.028

Rank 3 · TkA04G322400 · TK1151

Endoplasmic reticulum0.019

Rank 4 · TkA04G322400 · TK1151

Plastid0.013

Rank 5 · TkA04G322400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00265TK314-373 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G322400	`PF00265`	TK	314	373	1.7e-14	54.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S750`	Arabidopsis thaliana	sp\|Q9S750\|KITHA_ARATH Thymidine kinase a	47.400%	Swiss-Prot	Low
`F4KBF5`	Arabidopsis thaliana	sp\|F4KBF5\|KITHB_ARATH Thymidine kinase b	45.600%	Swiss-Prot	Low
`Q9LSE2`	Arabidopsis thaliana	sp\|Q9LSE2\|ICE1_ARATH Transcription factor ICE1	33.500%	Swiss-Prot	Medium
`Q9LPW3`	Arabidopsis thaliana	sp\|Q9LPW3\|SCRM2_ARATH Transcription factor SCREAM2	41.100%	Swiss-Prot	Low
`O81263`	Oryza sativa subsp. japonica	sp\|O81263\|KITH_ORYSJ Thymidine kinase	64.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card