Gene Card
Gene overview
cDNA / CDS / Protein Sequences
846 bp · TkA04G320420|TK1151|cDNA
ATGTCGTCCCATATAGAGGCTTTGGATGATCTCCTACCCCCTCTCCTCCCTCCAGAGGATGCCCTCACCGGAGGAGATTATGAACCGACGCTTGAGCGGCTTTCTGTTGACAAAATGTTAACAAAATATTGCGGCGAGTTCGGGCGTGCCACACCATGGTTACGGTTTTCGCGGACCGTGAACAGGGTTGGACATGTGTACAAGGTTTGGAATGTGGATGGGATGTCGATAAAAGTGTTTGTGGGGTTGATCAGCCAGGT...
846 bp · TkA04G320420|TK1151|CDS
ATGTCGTCCCATATAGAGGCTTTGGATGATCTCCTACCCCCTCTCCTCCCTCCAGAGGATGCCCTCACCGGAGGAGATTATGAACCGACGCTTGAGCGGCTTTCTGTTGACAAAATGTTAACAAAATATTGCGGCGAGTTCGGGCGTGCCACACCATGGTTACGGTTTTCGCGGACCGTGAACAGGGTTGGACATGTGTACAAGGTTTGGAATGTGGATGGGATGTCGATAAAAGTGTTTGTGGGGTTGATCAGCCAGGT...
Protein
Download Protein FASTA281 aa · TkA04G320420|TK1151|PROTEIN
MSSHIEALDDLLPPLLPPEDALTGGDYEPTLERLSVDKMLTKYCGEFGRATPWLRFSRTVNRVGHVYKVWNVDGMSIKVFVGLISQVSGSGMMVTGGRRWLSGDWCVEKNTRLGAGVFGHLSDSKLGRKGSLTIVCILSFVFGMMTSISPNYWTYVLLRVLTGFSTGGVGLCAFVLATEAVGPTKHGIAGMSTYFFSIGITLLTGIAYIFRSWRSLYIASSIPSIIFLVFILPFISESPRWCLVRGQTDQAMKIMHNIAK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G320420 |
|---|---|
| TK1151 ID | TkA04G320420 |
| OH-1004 ID | LXL04_037535 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 97.900 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 57.317Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G320420 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:80936929-80938011 (-) | |||||||||
| Description | Similar to OCT4: Organic cation/carnitine transporter 4 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006811 monoatomic ion transport Biological Process GO:0010150 leaf senescence Biological Process GO:0015839 cadaverine transport Biological Process GO:0042631 cellular response to water deprivation Biological Process GO:0070417 cellular response to cold Biological Process GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0009705 plant-type vacuole membrane Cellular Component GO:0016020 membrane Cellular Component GO:0005524 ATP binding Molecular Function GO:0015226 carnitine transmembrane transporter activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G16390 ath:AT1G73220 ath:AT1G79360 ath:AT3G20660 dme:Dmel_CG6331 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00083Sugar_tr114-262 aaPF07690MFS_1114-239 aaPF04123DUF373123-270 aaPF06692MNSV_P7B129-156 aaPF25452TM225132-224 aaPF06692MNSV_P7B225-235 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G320420 | PF00083 | Sugar_tr | 114 | 262 | 3.6e-17 | 63.1 |
| TkA04G320420 | PF07690 | MFS_1 | 114 | 239 | 8.4e-10 | 38.8 |
| TkA04G320420 | PF04123 | DUF373 | 123 | 270 | 0.048 | 13.8 |
| TkA04G320420 | PF06692 | MNSV_P7B | 129 | 156 | 0.052 | 14.3 |
| TkA04G320420 | PF25452 | TM225 | 132 | 224 | 1.0 | 10.1 |
| TkA04G320420 | PF06692 | MNSV_P7B | 225 | 235 | 0.052 | 14.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.