TkA04G316290 | RubberDandelionOmics

Gene overview

TkA04G316290

Reference: TK1151 Chr: Chr04 Coordinates: 79762168-79764837 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1475 bp · TkA04G316290|TK1151|cDNA

ATGCACAATTTGTTGTACAGGGTTGTGGTTAGTCATTCTTTGTATGAATATGATGATGCGCCCAATGAATCCACCTCCACCGGCACCTGCACCGTGGGTCCCACCATTGCCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCAAATTTCCTTAAAGGAATTACAGAACACCATCGATCTTGTAGAAGCTATGAACGTGAGCAGTTTGACCAAGCTGACCGAGAAGCCGATGAATGGAGGGCTAGGGAAATTAC...

CDS

Download CDS FASTA

858 bp · TkA04G316290|TK1151|CDS

ATGCACAATTTGTTGTACAGGGTTGTGGTTAGTCATTCTTTGTATGAATATGATGATGCGCCCAATGAATCCACCTCCACCGGCACCTGCACCGTGGGTCCCACCATTGCCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCAAATTTCCTTAAAGGAATTACAGAACACCATCGATCTTGTAGAAGCTATGAACGTGAGCAGTTTGACCAAGCTGACCGAGAAGCCGATGAATGGAGGGCTAGGGAAATTAC...

Protein

Download Protein FASTA

285 aa · TkA04G316290|TK1151|PROTEIN

MHNLLYRVVVSHSLYEYDDAPNESTSTGTCTVGPTIAPNDKWLLERYKCSNFLKGITEHHRSCRSYEREQFDQADREADEWRAREITNEVAKQRVEKMKEIAKQKAKEERKRLESELELVLIVEKLQELRSIRIQKLRKQGHFLPEEDNKFLERIRVAVEEEERQLMAAADTSAAKDAITSALNSKDQITAKDDKDNQVIKEKTNEKEVVDVDNHSKGSYDYSSNLLLELYHYYHGSSTDMGTLIEVRQTWDAYIRPGGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G316290`
TK1151 ID	TkA04G316290
OH-1004 ID	LXL04_037519
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 77.544 / OH-1004 99.103 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G316290

Location Chr04:79762168-79764837 (+)

Description Similar to SNRNP59: U11/U12 small nuclear ribonucleoprotein 59 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46200`	U11/U12 small nuclear ribonucleoprotein 59 kDa protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037519 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0051384 response to glucocorticoid Biological Process

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0034693 U11/U12 snRNP Cellular Component

GO:0071016 U12-type precatalytic spliceosome Cellular Component

GO:0089701 U2AF complex Cellular Component

KEGG gene cross-reference

ath:AT2G46200

hsa:10081

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.579

Rank 1 · TkA04G316290 · TK1151

Cytoplasm0.357

Rank 2 · TkA04G316290 · TK1151

Cell membrane0.065

Rank 3 · TkA04G316290 · TK1151

Mitochondrion0.043

Rank 4 · TkA04G316290 · TK1151

Golgi apparatus0.029

Rank 5 · TkA04G316290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01412ArfGap48-112 aa

PF23298FZ_RECK49-105 aa

PF16524RisS_PPD52-103 aa

PF16021PDCD763-280 aa

PF26360MIB_M168-112 aa

PF16524RisS_PPD121-162 aa

PF01412ArfGap160-210 aa

PF26360MIB_M1180-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G316290	`PF01412`	ArfGap	48	112	1.6	9.6
TkA04G316290	`PF23298`	FZ_RECK	49	105	0.25	12.1
TkA04G316290	`PF16524`	RisS_PPD	52	103	0.37	11.9
TkA04G316290	`PF16021`	PDCD7	63	280	1.4e-18	67.9
TkA04G316290	`PF26360`	MIB_M1	68	112	0.18	12.3
TkA04G316290	`PF16524`	RisS_PPD	121	162	0.37	11.9
TkA04G316290	`PF01412`	ArfGap	160	210	1.6	9.6
TkA04G316290	`PF26360`	MIB_M1	180	230	0.18	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYD3`	Arabidopsis thaliana	sp\|Q8VYD3\|U1159_ARATH U11/U12 small nuclear ribonucleoprotein 59 kDa protein	47.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card