TkA04G308260 | RubberDandelionOmics

Gene overview

TkA04G308260

Reference: TK1151 Chr: Chr04 Coordinates: 77771892-77774264 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1066 bp · TkA04G308260|TK1151|cDNA

CAGAGCCAGGTTTCGATCCTGGGACCTGTGGGTTATGGGCCCACCACGCTTCCGCTGCGCCACTCTGATTTGGTGATTGTAATAAATCAATAGCTCTCTTCTGCACTAGATTCTAGCCGATTGTATCATCGCACCATGAGACGCCGACCAGGGATCGGTGGCTTACAGACTGCCGCCGCCGCTAGAGATCAATATCGATTACTCGGAGAAAATGTAGCCAAGTTAAGAACCGATCTCATGAAAGAACAGCTTTCCACTTT...

CDS

Download CDS FASTA

756 bp · TkA04G308260|TK1151|CDS

ATGAGACGCCGACCAGGGATCGGTGGCTTACAGACTGCCGCCGCCGCTAGAGATCAATATCGATTACTCGGAGAAAATGTAGCCAAGTTAAGAACCGATCTCATGAAAGAACAGCTTTCCACTTTTCGTTCTCAATTAGAAGACTTTGCTCGCAAACACAAGAATGACATCCGAAAGAACCCTGTTTTCAGATCACAGTTCCATGAGATGTGTGCAAAAGTAGGTGTGGATCCACTAGCATCAAACAAAGGTTTCTGGGC...

Protein

Download Protein FASTA

251 aa · TkA04G308260|TK1151|PROTEIN

MRRRPGIGGLQTAAAARDQYRLLGENVAKLRTDLMKEQLSTFRSQLEDFARKHKNDIRKNPVFRSQFHEMCAKVGVDPLASNKGFWAELLGIGDFYYELGVQIVDICLATRPHNGGLINLEELCKILSQRRKGAREAVSEDDCLRAISKLKVLGSGFEVITVGKRKLVRSVPTELKKDHNEILELSQAQGFVTVEEVERRLSWPTGRAIDALDTLLDEGLAMIDDGHRDGKRRYWFPCVSSISSFVASDTL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G308260`
TK1151 ID	TkA04G308260
OH-1004 ID	LXL04_037438
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G308260

Location Chr04:77771892-77774264 (-)

Description Similar to VP22-1: Vacuolar protein sorting-associated protein 22 homolog 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27040`	Component of the endosomal sorting complex required for transport II (ESCRT-II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037438 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0016236 macroautophagy Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0036258 multivesicular body assembly Biological Process

GO:0042176 regulation of protein catabolic process Biological Process

GO:0043328 protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0045022 early endosome to late endosome transport Biological Process

GO:0045732 positive regulation of protein catabolic process Biological Process

GO:0061635 regulation of protein complex stability Biological Process

GO:0071985 multivesicular body sorting pathway Biological Process

KEGG gene cross-reference

ath:AT4G27040

hsa:11267

mmu:27681

rno:287645

xtr:496607

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.532

Rank 1 · TkA04G308260 · TK1151

Nucleus0.523

Rank 2 · TkA04G308260 · TK1151

Lysosome / Vacuole0.036

Rank 3 · TkA04G308260 · TK1151

Golgi apparatus0.034

Rank 4 · TkA04G308260 · TK1151

Mitochondrion0.034

Rank 5 · TkA04G308260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04157EAP306-225 aa

PF20975DGCcoil12-60 aa

PF23005DUF703233-73 aa

PF14394DUF442333-55 aa

PF05600CDK5RAP335-77 aa

PF23005DUF7032120-133 aa

PF20975DGCcoil161-197 aa

PF14394DUF4423181-223 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G308260	`PF04157`	EAP30	6	225	4.8e-57	193.8
TkA04G308260	`PF20975`	DGCcoil	12	60	0.17	11.7
TkA04G308260	`PF23005`	DUF7032	33	73	0.18	12.3
TkA04G308260	`PF14394`	DUF4423	33	55	0.18	12.3
TkA04G308260	`PF05600`	CDK5RAP3	35	77	0.033	13.7
TkA04G308260	`PF23005`	DUF7032	120	133	0.18	12.3
TkA04G308260	`PF20975`	DGCcoil	161	197	0.17	11.7
TkA04G308260	`PF14394`	DUF4423	181	223	0.18	12.3
TkA04G308260	`PF01978`	TrmB	190	231	0.13	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5M759`	Arabidopsis thaliana	sp\|Q5M759\|VP221_ARATH Vacuolar protein sorting-associated protein 22 homolog 1	83.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card