TkA04G276140 | RubberDandelionOmics

Gene overview

TkA04G276140

Reference: TK1151 Chr: Chr04 Coordinates: 69730668-69734064 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1662 bp · TkA04G276140|TK1151|cDNA

ATTCATCCACAAAAAACAGTCACAGCTAAGCAAACCCTCATTCCTTCTTCGGAGTAGCTTCTTCAGCCGGTGTTGTTTCTTACTCCGACGCTCAAACAGTTATTAAACTTGAGTCTATATATGCCGGTTCTTCCTCCCGCTCCAACCTCACTCCTCGACCTAGAATTCTAGTTGGTATGGTTCGAAAATTGACGCTCTTCTCATGTCGTCTATCTATAAATTGACGCTAGAAGGTTATACGTGTGCTTCAAATGGAGGTC...

CDS

Download CDS FASTA

900 bp · TkA04G276140|TK1151|CDS

ATGCTTTTCAGCGCAACCTTCCCATCGGAGATTCAGAGGCTTGCGTCTGATTTTCTCTCCAACTACATATTTCTTTGCGTCAGAAGAGTCGGTTCCAGCACCGATTTGATTCTCCAAAAAGTCGTATTTGTCGAAGATATGGAAAAATGCGAGGTTTTAAGAAATCTTCGTCACGATCAGAAAGCTAACGGAAACCTTGGAAAGAATGCATTGGTTGTGATTTTTGTGGAGACGAAACGGGCTGCAGATACTTTGGAAAG...

Protein

Download Protein FASTA

299 aa · TkA04G276140|TK1151|PROTEIN

MLFSATFPSEIQRLASDFLSNYIFLCVRRVGSSTDLILQKVVFVEDMEKCEVLRNLRHDQKANGNLGKNALVVIFVETKRAADTLESWLCRIGFPATAIHEIEGTKSDSGGELVLGGNSSKGLTSFPNYLVLHMRKFVMEAGWLPKKLGINIYLTTIVPVLYVYIDADDIIDISHMRSKGLQPGQELLPKDALGGQEEPTKVLPNEDIVSQLAGMGFNYLHCQKAAINTSNVAVEKAMNWLLSHMDDPVLMVFCVLLSLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G276140`
TK1151 ID	TkA04G276140
OH-1004 ID	LXL04_037353
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G276140

Location Chr04:69730668-69734064 (-)

Description Similar to UBP14: Ubiquitin carboxyl-terminal hydrolase 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20630`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	The ubiquitin-specific protease UBP14 is essential for early embryo development in Arabidopsis thaliana.2001 · DOI: 10.1046/j.1365-313x.2001.01106.x
`At3g58570`	DEAD-box ATP-dependent RNA helicase 52.	No verified direct reference in this release
`At2g42520`	DEAD-box ATP-dependent RNA helicase 37.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0202100`	DEAD-box ATP-dependent RNA helicase 52B.	No verified direct reference in this release
`Os03g0805200`	DEAD-box ATP-dependent RNA helicase 37.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037353 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0048767 root hair elongation Biological Process

GO:0071370 cellular response to gibberellin stimulus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT2G42520

ath:AT3G20630

ath:AT3G58570

dosa:Os03g0805200

dosa:Os07g0202100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.464

Rank 1 · TkA04G276140 · TK1151

Nucleus0.384

Rank 2 · TkA04G276140 · TK1151

Mitochondrion0.111

Rank 3 · TkA04G276140 · TK1151

Endoplasmic reticulum0.098

Rank 4 · TkA04G276140 · TK1151

Cell membrane0.064

Rank 5 · TkA04G276140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15454LAMTOR167-188 aa

PF00627UBA204-241 aa

PF22562UBA_7205-248 aa

PF25025EF-Ts_N216-242 aa

PF09384UTP15_C224-280 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G276140	`PF15454`	LAMTOR	167	188	0.39	12.1
TkA04G276140	`PF00627`	UBA	204	241	4e-06	27.3
TkA04G276140	`PF22562`	UBA_7	205	248	8.7e-16	58.3
TkA04G276140	`PF25025`	EF-Ts_N	216	242	0.32	11.7
TkA04G276140	`PF09384`	UTP15_C	224	280	0.057	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L6Y1`	Arabidopsis thaliana	sp\|Q8L6Y1\|UBP14_ARATH Ubiquitin carboxyl-terminal hydrolase 14	65.400%	Swiss-Prot	Low
`Q9M2F9`	Arabidopsis thaliana	sp\|Q9M2F9\|RH52_ARATH DEAD-box ATP-dependent RNA helicase 52	70.000%	Swiss-Prot	Low
`Q84W89`	Arabidopsis thaliana	sp\|Q84W89\|RH37_ARATH DEAD-box ATP-dependent RNA helicase 37	67.000%	Swiss-Prot	Low
`Q6Z4K6`	Oryza sativa subsp. japonica	sp\|Q6Z4K6\|RH52B_ORYSJ DEAD-box ATP-dependent RNA helicase 52B	67.000%	Swiss-Prot	Low
`Q75HJ0`	Oryza sativa subsp. japonica	sp\|Q75HJ0\|RH37_ORYSJ DEAD-box ATP-dependent RNA helicase 37	67.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card