TkA04G271450 | RubberDandelionOmics

Gene overview

TkA04G271450

Reference: TK1151 Chr: Chr04 Coordinates: 68598564-68600850 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1297 bp · TkA04G271450|TK1151|cDNA

CGACGTCGTGATGACGATGTGGTGACGTGATTCATAGATACAAATAACACGAAGTGGCGTTCACCGGTATTCCTTTGACCTTCTTCTCTTCCCTCCTTTCCCTTCCCCTGTATATATATATATACATGTGAGAAACTTGCCTTTTATTCTCACCCAAATGTCGACTGATCCTCGTACCGTTGTTAGAAAGTTTCTTGCCAGGCCTCAACATGAAGGCGTTGGAGCCGTCGTTAGACGGAGCATCGGAAGGTTTGAGCTTA...

CDS

Download CDS FASTA

885 bp · TkA04G271450|TK1151|CDS

ATGTCGACTGATCCTCGTACCGTTGTTAGAAAGTTTCTTGCCAGGCCTCAACATGAAGGCGTTGGAGCCGTCGTTAGACGGAGCATCGGAAGGTTTGAGCTTAAATACTTTGATCCTTTCCTTGTTTTGGATGAATTCTCAGTAACTGCTCCTGCTGGATTTCCTGATCATCCACATCGAGGATTTGAGACTGTCACATACATGTTACAGGGAGCTGTAACACATGAAGACTTTGAGGGACACAAAGGGACCATCGGAGT...

Protein

Download Protein FASTA

294 aa · TkA04G271450|TK1151|PROTEIN

MSTDPRTVVRKFLARPQHEGVGAVVRRSIGRFELKYFDPFLVLDEFSVTAPAGFPDHPHRGFETVTYMLQGAVTHEDFEGHKGTIGVGDLQWMTAGRGIVHSEMPAAHGTQKGLQLWINLSSTHKMIEPMYQEMASRNIAEATEDGVTVRIIAGERLGMKSPIYTRTPTMFLDFTMEPGAHVEQPIPESWNAFVYVLEGEGVIGNSSSKSSSTTASAHHILLLGPGDGVEVWNKSSKSLRFILVGGEPLGEPVVQWGPFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G271450`
TK1151 ID	TkA04G271450
OH-1004 ID	LXL04_037313
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G271450

Location Chr04:68598564-68600850 (+)

Description Similar to Pirin-like protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50590`	Pirin-like protein At1g50590.	No verified direct reference in this release
`At2g43120`	Involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum.	PIRIN2 stabilizes cysteine protease XCP2 and increases susceptibility to the vascular pathogen Ralstonia solanacearum in Arabidopsis.2014 · DOI: 10.1111/tpj.12602
`At3g59220`	Involved in abscisic acid signal transduction.	The GCR1, GPA1, PRN1, NF-Y signal chain mediates both blue light and abscisic acid responses in Arabidopsis.2007 · DOI: 10.1104/pp.106.089904
`At3g59260`	Putative pirin-like protein At3g59260.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037313 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0007586 digestion Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009785 blue light signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016604 nuclear body Cellular Component

GO:0003712 transcription coregulator activity Molecular Function

KEGG gene cross-reference

ath:AT1G50590

ath:AT2G43120

ath:AT3G59220

hsa:8544

sly:543607

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.634

Rank 1 · TkA04G271450 · TK1151

Nucleus0.303

Rank 2 · TkA04G271450 · TK1151

Peroxisome0.136

Rank 3 · TkA04G271450 · TK1151

Mitochondrion0.107

Rank 4 · TkA04G271450 · TK1151

Cell membrane0.064

Rank 5 · TkA04G271450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02678Pirin25-118 aa

PF05899Cupin_351-96 aa

PF07883Cupin_253-96 aa

PF05726Pirin_C59-94 aa

PF05899Cupin_3144-156 aa

PF05726Pirin_C172-279 aa

PF07883Cupin_2174-242 aa

PF05899Cupin_3190-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G271450	`PF02678`	Pirin	25	118	5.5e-31	107.5
TkA04G271450	`PF05899`	Cupin_3	51	96	0.017	15.5
TkA04G271450	`PF07883`	Cupin_2	53	96	3.1e-06	27.5
TkA04G271450	`PF05726`	Pirin_C	59	94	2.1e-33	115.5
TkA04G271450	`PF05899`	Cupin_3	144	156	0.017	15.5
TkA04G271450	`PF05726`	Pirin_C	172	279	2.1e-33	115.5
TkA04G271450	`PF07883`	Cupin_2	174	242	3.1e-06	27.5
TkA04G271450	`PF05899`	Cupin_3	190	207	0.017	15.5
TkA04G271450	`PF02678`	Pirin	194	229	5.5e-31	107.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPS9`	Arabidopsis thaliana	sp\|Q9LPS9\|PRNL1_ARATH Pirin-like protein At1g50590	65.400%	Swiss-Prot	High
`Q9ZW82`	Arabidopsis thaliana	sp\|Q9ZW82\|PRNL2_ARATH Pirin-like protein 2	63.100%	Swiss-Prot	High
`Q9LX49`	Arabidopsis thaliana	sp\|Q9LX49\|PRN1_ARATH Pirin-1	58.600%	Swiss-Prot	High
`Q9LX45`	Arabidopsis thaliana	sp\|Q9LX45\|PRNL4_ARATH Putative pirin-like protein At3g59260	55.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card