TkA04G230840 | RubberDandelionOmics

Gene overview

TkA04G230840

Reference: TK1151 Chr: Chr04 Coordinates: 58642224-58648967 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2241 bp · TkA04G230840|TK1151|cDNA

AGCGGCAGAAAAAGGCGAAGAAGCCCCAAATTTCAAATCTCTCAGATTCCTCTGTCCGAATCCACTGTTGCTTTCTAGGTTGTAGATGCAGAGGAGGTGAAACAAAATGGTAGCTGTTAAGGGATTAAGCACGTTTAAAAGTAGAGTTTCAGCAGAGCGGGAGACCAGGAAGAGTGCAGGCGGAATCAAAAGCTTCAAGGTGTATACAGATAATGAAAAGGCTAGAGTTCAGAGCCGGGATCCTGTTGCTGCTGAAGCCA...

CDS

Download CDS FASTA

1899 bp · TkA04G230840|TK1151|CDS

ATGGTAGCTGTTAAGGGATTAAGCACGTTTAAAAGTAGAGTTTCAGCAGAGCGGGAGACCAGGAAGAGTGCAGGCGGAATCAAAAGCTTCAAGGTGTATACAGATAATGAAAAGGCTAGAGTTCAGAGCCGGGATCCTGTTGCTGCTGAAGCCAAAAAGAAGTCAATGCTAGTCAAAGCTGAAACCAGTCAAATTCAAGCCAACTGTCCAAAGGGTGTTTTTAACAAGTTGGAAAAGATTCATGGGAAAAACATCATTTC...

Protein

Download Protein FASTA

632 aa · TkA04G230840|TK1151|PROTEIN

MVAVKGLSTFKSRVSAERETRKSAGGIKSFKVYTDNEKARVQSRDPVAAEAKKKSMLVKAETSQIQANCPKGVFNKLEKIHGKNIISTKSTVARKVLGDISNSQGSLQKTEVFDGSKLGKSKLEKTAYSQRSSVGTKARNRSSLPGKLSLGIRVGSQCEAGSNRLTLSRVGTKDLKVFNGGNSRLRLQGKETVGCVKRESLRNYNPPPKRKTLPVIKHVEKTDTCDLKKGTLGLKIKEKHVFSVKPKLGTSLVPQVRNRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G230840`
TK1151 ID	TkA04G230840
OH-1004 ID	LXL04_039340
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G230840

Location Chr04:58642224-58648967 (+)

Description Similar to CYCB3-1: Putative cyclin-B3-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16330`	Putative cyclin-B3-1.	No verified direct reference in this release
`At5g06150`	May induce mitotic cell division.	No verified direct reference in this release
`At3g11520`	Cyclin-B1-3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0493500`	Cyclin-B1-5.	No verified direct reference in this release
`Os01g0281200`	Cyclin-B1-3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039340 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000082 G1/S transition of mitotic cell cycle Biological Process

GO:0010332 response to gamma radiation Biological Process

GO:0051301 cell division Biological Process

GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016538 cyclin-dependent protein serine/threonine kinase regulator activity Molecular Function

KEGG gene cross-reference

ath:AT1G16330

ath:AT3G11520

ath:AT5G06150

dosa:Os05g0493500

gmx:547920

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.824

Rank 1 · TkA04G230840 · TK1151

Cytoplasm0.202

Rank 2 · TkA04G230840 · TK1151

Mitochondrion0.032

Rank 3 · TkA04G230840 · TK1151

Cell membrane0.025

Rank 4 · TkA04G230840 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA04G230840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17213Hydin_ADK44-91 aa

PF06497Baculo_Ac10278-107 aa

PF06497Baculo_Ac102270-289 aa

PF17213Hydin_ADK270-373 aa

PF06497Baculo_Ac102350-375 aa

PF00134Cyclin_N381-507 aa

PF02984Cyclin_C510-625 aa

PF00134Cyclin_N535-561 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G230840	`PF17213`	Hydin_ADK	44	91	7.8	7.3
TkA04G230840	`PF06497`	Baculo_Ac102	78	107	2.2	9.1
TkA04G230840	`PF06497`	Baculo_Ac102	270	289	2.2	9.1
TkA04G230840	`PF17213`	Hydin_ADK	270	373	7.8	7.3
TkA04G230840	`PF06497`	Baculo_Ac102	350	375	2.2	9.1
TkA04G230840	`PF00134`	Cyclin_N	381	507	3.2e-39	134.3
TkA04G230840	`PF02984`	Cyclin_C	510	625	2.4e-32	112.1
TkA04G230840	`PF00134`	Cyclin_N	535	561	3.2e-39	134.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA32`	Arabidopsis thaliana	sp\|Q9SA32\|CCB31_ARATH Putative cyclin-B3-1	61.300%	Swiss-Prot	Low
`Q39067`	Arabidopsis thaliana	sp\|Q39067\|CCB12_ARATH Cyclin-B1-2	45.000%	Swiss-Prot	Low
`Q39069`	Arabidopsis thaliana	sp\|Q39069\|CCB13_ARATH Cyclin-B1-3	42.700%	Swiss-Prot	Low
`Q0DH40`	Oryza sativa subsp. japonica	sp\|Q0DH40\|CCB15_ORYSJ Cyclin-B1-5	42.900%	Swiss-Prot	Low
`Q0JNK6`	Oryza sativa subsp. japonica	sp\|Q0JNK6\|CCB13_ORYSJ Cyclin-B1-3	43.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card