TkA04G224110 | RubberDandelionOmics

Gene overview

TkA04G224110

Reference: TK1151 Chr: Chr04 Coordinates: 57015640-57016593 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

888 bp · TkA04G224110|TK1151|cDNA

ATGGAGGCTGTCGTAGAACAATCCACCATCCTCACCCCTGGTGATGGTGTTGATCATGATGATGGTGACGCTGCTCCGAAGGATATCACGAACATCTCAAAAGGCAAACGCACCAAGCGCCAAAGGCCACAATCCCCAATTCTTTTCACATTTTCATCGGCCAACAATAATGATTCAAATGATTCTCCGGTATCTTCTTCTGGTTTTCCGGCAGGTAGCACCACCACGGAGGATGAAGACACTGCCGAGACCCTTATCCT...

CDS

Download CDS FASTA

888 bp · TkA04G224110|TK1151|CDS

ATGGAGGCTGTCGTAGAACAATCCACCATCCTCACCCCTGGTGATGGTGTTGATCATGATGATGGTGACGCTGCTCCGAAGGATATCACGAACATCTCAAAAGGCAAACGCACCAAGCGCCAAAGGCCACAATCCCCAATTCTTTTCACATTTTCATCGGCCAACAATAATGATTCAAATGATTCTCCGGTATCTTCTTCTGGTTTTCCGGCAGGTAGCACCACCACGGAGGATGAAGACACTGCCGAGACCCTTATCCT...

Protein

Download Protein FASTA

295 aa · TkA04G224110|TK1151|PROTEIN

MEAVVEQSTILTPGDGVDHDDGDAAPKDITNISKGKRTKRQRPQSPILFTFSSANNNDSNDSPVSSSGFPAGSTTTEDEDTAETLILLSRGRSRNYDDGIFKFNSKRYIHTSTTGNTRVIVYECRTCNRTFSSFQALGGHRASHKKPKNNQDMRKPPPYLNNRASFTTKSSSKLHECSICGTEFNSGQALGGHMRRHRVAGVANKGGNLRTSNTTLSLIPFTPMTTVEVYENKSNNNALCLDLNLPAPREASTVAAGDDQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G224110`
TK1151 ID	TkA04G224110
OH-1004 ID	LXL04_039378
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G224110

Location Chr04:57015640-57016593 (-)

Description Similar to ZAT5: Zinc finger protein ZAT5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28200`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At3g60580`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At5g67450`	Transcriptional repressor involved in the inhibition of plant growth under abiotic stress conditions.	Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions.2004 · DOI: 10.1104/pp.104.046599 Arabidopsis Cys2/His2 zinc-finger proteins AZF1 and AZF2 negatively regulate abscisic acid-repressive and auxin-inducible genes under abiotic stress conditions.2011 · DOI: 10.1104/pp.111.182683
`At3g19580`	Transcriptional repressor involved in the inhibition of plant growth under abiotic stress conditions.	Functional identification of an Arabidopsis snf4 ortholog by screening for heterologous multicopy suppressors of snf4 deficiency in yeast.2000 · DOI: 10.1046/j.1365-313x.2000.00809.x Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions.2004 · DOI: 10.1104/pp.104.046599 Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells.2008 · DOI: 10.1073/pnas.0711203105 Arabidopsis zinc-finger protein 2 is a negative regulator of ABA signaling during seed germination.2010 · DOI: 10.1016/j.jplph.2010.05.010 Arabidopsis Cys2/His2 zinc-finger proteins AZF1 and AZF2 negatively regulate abscisic acid-repressive and auxin-inducible genes under abiotic stress conditions.2011 · DOI: 10.1104/pp.111.182683 Gene network analysis and functional studies of senescence-associated genes reveal novel regulators of Arabidopsis leaf senescence.2012 · DOI: 10.1111/j.1744-7909.2012.01136.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039378 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009611 response to wounding Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009631 cold acclimation Biological Process

KEGG gene cross-reference

ath:AT2G28200

ath:AT2G37430

ath:AT3G46080

ath:AT3G53600

ath:AT5G59820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.981

Rank 1 · TkA04G224110 · TK1151

Cytoplasm0.068

Rank 2 · TkA04G224110 · TK1151

Cell membrane0.024

Rank 3 · TkA04G224110 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA04G224110 · TK1151

Plastid0.010

Rank 5 · TkA04G224110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13913zf-C2HC_2102-108 aa

PF02150Zn_ribbon_RPB9115-128 aa

PF25909zf-C2H2_AHC1119-153 aa

PF23455DUF7129120-133 aa

PF13912zf-C2H2_6121-147 aa

PF23107Zf-C2H2_ZNF451_C121-150 aa

PF13894zf-C2H2_4122-144 aa

PF00096zf-C2H2122-144 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G224110	`PF13913`	zf-C2HC_2	102	108	0.014	15.8
TkA04G224110	`PF02150`	Zn_ribbon_RPB9	115	128	0.22	12.2
TkA04G224110	`PF25909`	zf-C2H2_AHC1	119	153	0.12	13.0
TkA04G224110	`PF23455`	DUF7129	120	133	0.0074	16.7
TkA04G224110	`PF13912`	zf-C2H2_6	121	147	5.2e-24	84.4
TkA04G224110	`PF23107`	Zf-C2H2_ZNF451_C	121	150	0.25	12.7
TkA04G224110	`PF13894`	zf-C2H2_4	122	144	1.5e-09	38.4
TkA04G224110	`PF00096`	zf-C2H2	122	144	3.4e-06	27.9
TkA04G224110	`PF12874`	zf-met	122	144	0.00012	23.0
TkA04G224110	`PF12756`	zf-C2H2_2	122	147	0.00082	20.3
TkA04G224110	`PF12171`	zf-C2H2_jaz	122	145	0.00082	20.2
TkA04G224110	`PF09723`	Zn_ribbon_8	122	137	0.031	15.0
TkA04G224110	`PF24485`	zf-C2H2_DHX34	122	132	0.091	13.5
TkA04G224110	`PF13913`	zf-C2HC_2	123	131	0.014	15.8
TkA04G224110	`PF17123`	zf-RING_11	123	137	0.13	12.8
TkA04G224110	`PF16622`	zf-C2H2_11	123	141	7.7	7.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q681X4`	Arabidopsis thaliana	sp\|Q681X4\|ZAT5_ARATH Zinc finger protein ZAT5	35.200%	Swiss-Prot	Medium
`Q9M202`	Arabidopsis thaliana	sp\|Q9M202\|ZAT9_ARATH Zinc finger protein ZAT9	35.400%	Swiss-Prot	Medium
`Q9SSW1`	Arabidopsis thaliana	sp\|Q9SSW1\|AZF1_ARATH Zinc finger protein AZF1	30.200%	Swiss-Prot	Medium
`Q9SSW2`	Arabidopsis thaliana	sp\|Q9SSW2\|AZF2_ARATH Zinc finger protein AZF2	31.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card