TkA04G209810 | RubberDandelionOmics

Gene overview

TkA04G209810

Reference: TK1151 Chr: Chr04 Coordinates: 53731490-53737054 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

969 bp · TkA04G209810|TK1151|cDNA

ATAATATCCTCTTCTTCCCCAATCCAGAACTTCCTACTAAATGTCAAATGCGCCGGCCGAATCTGCCGGAGTTAAATAGAGGATATGCTATTAGCGTCACCGGTGCGAAAGCTAGTGAGAGAAACGCATTAAAGCCGATCATGTTGCTTCACAGTTGGACCTTTTCTTGTACTTCTTCTTCCCGGTTGCTACATTCCGCAAGTCAAACCGGCGGAATCGATTGCGAAACTACTAGTGTGTATTTGAGAAGGAGAAAAATC...

CDS

Download CDS FASTA

1521 bp · TkA04G209810|TK1151|CDS

ATGAACCATCGATGGCGTTCAAATTCTTGTTGCATTTACTGCATGAAGCATAAAACCAACCAGAACCATGATCCACTTGTACTATCTTTGCTAAGAAAGGGGGAATCTGAAAAAATCAAAAATTTCACATTTCAGGTATCGTCTGTGAAGTTTCAATACACCGTTTTTGGTGCCGCCGTTTCTCCAAACTCTTCGTCGTCTTCACAGAAATCGCATGCATGCCGCATCCAATCAATCAAAGCGACTGCAACTCAGGCACC...

Protein

Download Protein FASTA

506 aa · TkA04G209810|TK1151|PROTEIN

MNHRWRSNSCCIYCMKHKTNQNHDPLVLSLLRKGESEKIKNFTFQVSSVKFQYTVFGAAVSPNSSSSSQKSHACRIQSIKATATQAPPAVPKSSTKAKTKVGINGFGRIGRLVLRIATSRDDIEVVAVNDPFIDSKYMAYMLKYDSTHGLFKGTINVIDESTLEINGKQIKQQFHGVILELTNVVESSGVFTTLDKAAAHKKGGAKKVVISAPSADAPMFVVYYELPTKCQMRRPNLPELNRGYAISVTGAKASERNALK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G209810`
TK1151 ID	TkA04G209810
OH-1004 ID	LXL04_039357
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.900
Protein coverage (%)	TK1151 54.941 / OH-1004 91.148 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G209810

Location Chr04:53731490-53737054 (-)

Description Similar to yuiD: Uncharacterized membrane protein YuiD (Bacillus subtilis (strain 168)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79530`	Involved in plastidial glycolytic pathway and plays a specific role in glycolytic energy production in non-green plastids and chloroplasts.	Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis.2009 · DOI: 10.1104/pp.109.143701 The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for viable pollen development in Arabidopsis.2010 · DOI: 10.1104/pp.109.150458
`At1g16300`	Involved in plastidial glycolytic pathway and plays a specific role in glycolytic energy production in non-green plastids and chloroplasts.	Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis.2009 · DOI: 10.1104/pp.109.143701 The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for viable pollen development in Arabidopsis.2010 · DOI: 10.1104/pp.109.150458

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039357 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

bsu:BSU32060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.910

Rank 1 · TkA04G209810 · TK1151

Mitochondrion0.094

Rank 2 · TkA04G209810 · TK1151

Cytoplasm0.036

Rank 3 · TkA04G209810 · TK1151

Nucleus0.032

Rank 4 · TkA04G209810 · TK1151

Cell membrane0.018

Rank 5 · TkA04G209810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19549DUF607263-95 aa

PF028262-Hacid_dh_C93-147 aa

PF00044Gp_dh_N100-193 aa

PF01113DapB_N100-131 aa

PF14481Fimbrial_PilY2224-266 aa

PF01113DapB_N296-334 aa

PF19549DUF6072299-324 aa

PF02681DUF212323-498 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G209810	`PF19549`	DUF6072	63	95	0.95	10.3
TkA04G209810	`PF02826`	2-Hacid_dh_C	93	147	0.0041	17.2
TkA04G209810	`PF00044`	Gp_dh_N	100	193	8.1e-25	87.8
TkA04G209810	`PF01113`	DapB_N	100	131	0.00094	20.0
TkA04G209810	`PF14481`	Fimbrial_PilY2	224	266	0.21	12.0
TkA04G209810	`PF01113`	DapB_N	296	334	0.00094	20.0
TkA04G209810	`PF19549`	DUF6072	299	324	0.95	10.3
TkA04G209810	`PF02681`	DUF212	323	498	4.4e-32	111.6
TkA04G209810	`PF01569`	PAP2	339	396	0.048	14.1
TkA04G209810	`PF00044`	Gp_dh_N	426	476	8.1e-25	87.8
TkA04G209810	`PF19549`	DUF6072	471	502	0.95	10.3
TkA04G209810	`PF01569`	PAP2	487	505	0.048	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SAJ6`	Arabidopsis thaliana	sp\|Q9SAJ6\|G3PP1_ARATH Glyceraldehyde-3-phosphate dehydrogenase GAPCP1, chloroplastic	67.400%	Swiss-Prot	Low
`Q5E924`	Arabidopsis thaliana	sp\|Q5E924\|G3PP2_ARATH Glyceraldehyde-3-phosphate dehydrogenase GAPCP2, chloroplastic	69.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card