TkA04G197370 | RubberDandelionOmics

Gene overview

TkA04G197370

Reference: TK1151 Chr: Chr04 Coordinates: 50839649-50841898 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1949 bp · TkA04G197370|TK1151|cDNA

GAGCAGGGGCTCTAAATCTGCCGGCCGGCCCTGCTTTTAACTAAACATATGACGAAAAATGTGATTTGGCAAAACGCAATCGTTATTCGTTGCCATACCAACTCCTGTGACTTTTAGAGTATAGCCCATCAACTGAATCGACTCTCCCTGAACGGAGCCCACAGAAAGCAAGACGCGTGCGAGGCGCGTGCTATTTATAGGCATACGTAGAAGTAGAAGCCCTCTTTCTTTGCATCCAAGAATCCTCCGAAATTACTCCA...

CDS

Download CDS FASTA

1137 bp · TkA04G197370|TK1151|CDS

ATGGTTAGGCGTACATTGAAGAAATTCGTGTATCCTTGTTGGAAGCCATCATTTATGGAAGGAGATAGTGAAAATAGCGGTAGAGAGGGCGATTTCGGTGGGATTGTGGATGGATTATGGTGGTACGAGGACTCTGGAAAACATGTTCATGGAGATTTTTCAATGGCAGTGATCCAAGCCAATATCGTGTTGGAGGATCAATGTCAACTTGAATCCGGATCTCTAAGCTCAATCGATTCCGGCCCTCAAGGAACCTTCGT...

Protein

Download Protein FASTA

378 aa · TkA04G197370|TK1151|PROTEIN

MVRRTLKKFVYPCWKPSFMEGDSENSGREGDFGGIVDGLWWYEDSGKHVHGDFSMAVIQANIVLEDQCQLESGSLSSIDSGPQGTFVGIYDGHAGPEASRFINHNLFNNIKKYTSESEGMSDSVIRQAYLATEEQFLSLVETQWLSNPKMASVGSCCLVGIICNGVLYIANAGDSRAVLAREEKSINGLKGVRVSEEHNAKFESIREELRSLHPDDPNIVVLKHNVWRVRALIQISRSIGDAYLKKPEFNREPLLPKFIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G197370`
TK1151 ID	TkA04G197370
OH-1004 ID	LXL04_034977
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G197370

Location Chr04:50839649-50841898 (-)

Description Similar to PP2C38: Probable protein phosphatase 2C 38

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55050`	May dephosphorylate and repress plasma membrane H(+)-ATPases (PM H(+)-ATPases, e.g. AHA1 and AHA2), thus influencing negatively plant growth and fitness.	No verified direct reference in this release
`At3g12620`	May dephosphorylate and repress plasma membrane H(+)-ATPases (PM H(+)-ATPases, e.g. AHA1 and AHA2), thus influencing negatively plant growth and fitness (By similarity).	The Arabidopsis Protein Phosphatase PP2C38 Negatively Regulates the Central Immune Kinase BIK1.2016 · DOI: 10.1371/journal.ppat.1005811
`At5g02760`	Dephosphorylates and represses plasma membrane H(+)-ATPases (PM H(+)-ATPases, e.g. AHA1 and AHA2), thus influencing negatively plant growth and fitness.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0717800`	Probable protein phosphatase 2C 60.	No verified direct reference in this release
`Os03g0137200`	Probable protein phosphatase 2C 28.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034977 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:1900425 negative regulation of defense response to bacterium Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G12620

ath:AT3G55050

ath:AT4G38520

dosa:Os03g0137200

dosa:Os06g0717800

osa:4331548

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.303

Rank 1 · TkA04G197370 · TK1151

Cytoplasm0.301

Rank 2 · TkA04G197370 · TK1151

Cell membrane0.244

Rank 3 · TkA04G197370 · TK1151

Endoplasmic reticulum0.111

Rank 4 · TkA04G197370 · TK1151

Golgi apparatus0.083

Rank 5 · TkA04G197370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C71-329 aa

PF13672PP2C_297-304 aa

PF10476DUF2448132-162 aa

PF22771ToxA_barrel200-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G197370	`PF00481`	PP2C	71	329	1.9e-38	133.3
TkA04G197370	`PF13672`	PP2C_2	97	304	0.0026	18.1
TkA04G197370	`PF10476`	DUF2448	132	162	0.1	13.2
TkA04G197370	`PF22771`	ToxA_barrel	200	231	0.06	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94CL8`	Arabidopsis thaliana	sp\|Q94CL8\|P2C48_ARATH Probable protein phosphatase 2C 48	59.800%	Swiss-Prot	High
`Q9LHJ9`	Arabidopsis thaliana	sp\|Q9LHJ9\|P2C38_ARATH Probable protein phosphatase 2C 38	62.600%	Swiss-Prot	High
`Q501F9`	Arabidopsis thaliana	sp\|Q501F9\|P2C67_ARATH Probable protein phosphatase 2C 67	58.000%	Swiss-Prot	High
`Q5Z8P0`	Oryza sativa subsp. japonica	sp\|Q5Z8P0\|P2C60_ORYSJ Probable protein phosphatase 2C 60	58.300%	Swiss-Prot	High
`Q10S32`	Oryza sativa subsp. japonica	sp\|Q10S32\|P2C28_ORYSJ Probable protein phosphatase 2C 28	58.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card