TkA04G195390 | RubberDandelionOmics

Gene overview

TkA04G195390

Reference: TK1151 Chr: Chr04 Coordinates: 50342779-50352139 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1086 bp · TkA04G195390|TK1151|cDNA

GGGGACATATTATTCAGTATCAATGCGAATAAATGCAAAAGCTCCTACACGTGGTATTGTAAGTAGAGGGATTGGTTTGGAAGGGTTTTGTAGTATATTAGCTGGGCTATGGGGTCGGGATCTGGGTCAACAACTTTGACCGAAAACACACACACCATTACCATCACAAAGGTAGCTTCTAGAAGGGCGGTGGAGCTAGGAGCAGTTATCTTAATCATCTTCTCTTTTGTAGGTAAATTGGGTGCCATTCTCGCATCGAT...

CDS

Download CDS FASTA

888 bp · TkA04G195390|TK1151|CDS

ATGAAGCATTGTAGGACCGATGCATCCAATGCATGGAAAACCGCCTATTGGATTAGGGTACCCTACCCTTTTCAATGGGGTATCCCCATTTTCCATTCAAGAACCGCCATTATTATGATTATCGTGTCCTTGGTGGCATCAGTTGACTCGGTGGGGACATATTATTCAGTATCAATGCGAATAAATGCAAAAGCTCCTACACGTGGTATTGTAAGTAGAGGGATTGGTTTGGAAGGGTTTTGTAGTATATTAGCTGGGCT...

Protein

Download Protein FASTA

295 aa · TkA04G195390|TK1151|PROTEIN

MKHCRTDASNAWKTAYWIRVPYPFQWGIPIFHSRTAIIMIIVSLVASVDSVGTYYSVSMRINAKAPTRGIVSRGIGLEGFCSILAGLWGSGAGSTTLTENTHTITITKVASRRAVELGAVILIIFSFVGKLGAILASIPQALAVSLLCFVWALITALGISTLRYTHTRSFRNIMIVGVSLFLGLSLPACFQNYNQETAFVLPAYLIPYSAASDGPIRSGNKQFDFVINALLSMNMVVTFMVAMVLDNTVPGSRLESGVYL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G195390`
TK1151 ID	TkA04G195390
OH-1004 ID	LXL04_034970
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 42.569 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G195390

Location Chr04:50342779-50352139 (-)

Description Similar to NAT11: Nucleobase-ascorbate transporter 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g38050`	Nucleobase-ascorbate transporter 11.	No verified direct reference in this release
`At2g27810`	Nucleobase-ascorbate transporter 12.	No verified direct reference in this release
`At5g49990`	Nucleobase-ascorbate transporter 5.	No verified direct reference in this release
`At1g60030`	Nucleobase-ascorbate transporter 7.	No verified direct reference in this release
`At5g62890`	Nucleobase-ascorbate transporter 6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034970 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0035344 hypoxanthine transport Biological Process

GO:0098702 adenine import across plasma membrane Biological Process

GO:0098710 guanine import across plasma membrane Biological Process

GO:0098721 uracil import across plasma membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G60030

ath:AT2G27810

ath:AT4G38050

ath:AT5G49990

ath:AT5G62890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.712

Rank 1 · TkA04G195390 · TK1151

Cytoplasm0.116

Rank 2 · TkA04G195390 · TK1151

Endoplasmic reticulum0.096

Rank 3 · TkA04G195390 · TK1151

Lysosome / Vacuole0.094

Rank 4 · TkA04G195390 · TK1151

Golgi apparatus0.041

Rank 5 · TkA04G195390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09867TagF_N1-59 aa

PF00860Xan_ur_permease6-190 aa

PF09843DUF207037-218 aa

PF08570DUF1761144-196 aa

PF08570DUF1761231-260 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G195390	`PF09867`	TagF_N	1	59	0.16	12.7
TkA04G195390	`PF00860`	Xan_ur_permease	6	190	4.3e-39	135.0
TkA04G195390	`PF09843`	DUF2070	37	218	9.7	5.0
TkA04G195390	`PF08570`	DUF1761	144	196	0.021	15.8
TkA04G195390	`PF08570`	DUF1761	231	260	0.021	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6SZ87`	Arabidopsis thaliana	sp\|Q6SZ87\|NAT11_ARATH Nucleobase-ascorbate transporter 11	69.500%	Swiss-Prot	High
`Q3E7D0`	Arabidopsis thaliana	sp\|Q3E7D0\|NAT12_ARATH Nucleobase-ascorbate transporter 12	53.400%	Swiss-Prot	High
`Q8RWE9`	Arabidopsis thaliana	sp\|Q8RWE9\|NAT5_ARATH Nucleobase-ascorbate transporter 5	37.200%	Swiss-Prot	Medium
`Q0WPE9`	Arabidopsis thaliana	sp\|Q0WPE9\|NAT7_ARATH Nucleobase-ascorbate transporter 7	36.500%	Swiss-Prot	Medium
`Q27GI3`	Arabidopsis thaliana	sp\|Q27GI3\|NAT6_ARATH Nucleobase-ascorbate transporter 6	37.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card