TkA04G193360 | RubberDandelionOmics

Gene overview

TkA04G193360

Reference: TK1151 Chr: Chr04 Coordinates: 49878336-49882185 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2052 bp · TkA04G193360|TK1151|cDNA

ATGTATGAGAGGTACCAGATGATGACTGATGTTTACACACTCATTCCGAATCATTTAGTCATGCTGAAACAAAAATTAATGGCTCAGAAGCGAAACTCTGATCAAGACAAGAAAGCTGTTTATGAAAGAATTGTCTGGAATCTTGTGAAAGTTACCGGAACAAGTGGGGGTAGGTGTGCAAGTATGGTGGTCTTAAGAAATGGTGTGGAAATAGGAGGTCACAATAGTGGGGCCGACAACCACAGTGGTGGGGCCGATAA...

CDS

Download CDS FASTA

2052 bp · TkA04G193360|TK1151|CDS

ATGTATGAGAGGTACCAGATGATGACTGATGTTTACACACTCATTCCGAATCATTTAGTCATGCTGAAACAAAAATTAATGGCTCAGAAGCGAAACTCTGATCAAGACAAGAAAGCTGTTTATGAAAGAATTGTCTGGAATCTTGTGAAAGTTACCGGAACAAGTGGGGGTAGGTGTGCAAGTATGGTGGTCTTAAGAAATGGTGTGGAAATAGGAGGTCACAATAGTGGGGCCGACAACCACAGTGGTGGGGCCGATAA...

Protein

Download Protein FASTA

683 aa · TkA04G193360|TK1151|PROTEIN

MYERYQMMTDVYTLIPNHLVMLKQKLMAQKRNSDQDKKAVYERIVWNLVKVTGTSGGRCASMVVLRNGVEIGGHNSGADNHSGGADNHNGKVDNHNGGWDEGRIATLVGQEIARAFREKRPPMLDAFRANVLGTIDAHIAAAMNADRGRGQGAGPDMHLRDFTSMRPPSYDGKKDPLVSRRWVNEMESAFFTAATPANDRVYFATYTLRDGARDWWTALSGSMTLQEREALTWDQFLQRFTREFMPPVEVERLAREYLDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G193360`
TK1151 ID	TkA04G193360
OH-1004 ID	LXL04_007969
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	68.900
Protein coverage (%)	TK1151 44.217 / OH-1004 86.877 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G193360`
Location	Chr04:49878336-49882185 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_007969` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.702

Rank 1 · TkA04G193360 · TK1151

Nucleus0.339

Rank 2 · TkA04G193360 · TK1151

Endoplasmic reticulum0.061

Rank 3 · TkA04G193360 · TK1151

Mitochondrion0.060

Rank 4 · TkA04G193360 · TK1151

Cell membrane0.059

Rank 5 · TkA04G193360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03732PEG10_N-capsid96-121 aa

PF03732PEG10_N-capsid165-244 aa

PF19259Ty3_capsid167-322 aa

PF14392zf-CCHC_4387-401 aa

PF00098zf-CCHC388-402 aa

PF27939DUF8363389-433 aa

PF30379SLU7_N389-401 aa

PF16588zf-C2H2_10390-395 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G193360	`PF03732`	PEG10_N-capsid	96	121	8.9e-11	42.7
TkA04G193360	`PF03732`	PEG10_N-capsid	165	244	8.9e-11	42.7
TkA04G193360	`PF19259`	Ty3_capsid	167	322	3.4e-10	40.4
TkA04G193360	`PF14392`	zf-CCHC_4	387	401	1.1	9.7
TkA04G193360	`PF00098`	zf-CCHC	388	402	1.7e-07	31.7
TkA04G193360	`PF27939`	DUF8363	389	433	0.087	13.4
TkA04G193360	`PF30379`	SLU7_N	389	401	0.31	11.3
TkA04G193360	`PF16588`	zf-C2H2_10	390	395	1.1	9.8
TkA04G193360	`PF00098`	zf-CCHC	409	425	1.7e-07	31.7
TkA04G193360	`PF12156`	ATPase-cat_bd	409	453	0.28	12.6
TkA04G193360	`PF30379`	SLU7_N	409	423	0.31	11.3
TkA04G193360	`PF16588`	zf-C2H2_10	409	424	1.1	9.8
TkA04G193360	`PF14392`	zf-CCHC_4	409	424	1.1	9.7
TkA04G193360	`PF08284`	RVP_2	450	559	2e-21	77.0
TkA04G193360	`PF30863`	PRO_PEG10-RTL1	462	550	0.037	15.2
TkA04G193360	`PF00098`	zf-CCHC	496	501	1.7e-07	31.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card