TkA04G192270 | RubberDandelionOmics

Gene overview

TkA04G192270

Reference: TK1151 Chr: Chr04 Coordinates: 49591368-49595631 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2847 bp · TkA04G192270|TK1151|cDNA

ATGAACAATAGTCTACCCCCAACGCGGAAGTCTTCTGATTTGATTGGCAAAGTGAAAGAGAAAGAGAATTAATGGTGTCTGTACTCTGTCGGTTGTCACATCTCTTTCAAATAATTGAAAGAAAATTGTTCCAGTTTAGCTCTCGTCTTCACAGCCTCACAGATACGTAACCTTATTTGCAAAGCCCGTGATGAATTTCATATTCATGGCCCAATTACTGCTTGCATTTCTCATCTTTCAGTTTGTCCAAACCAATGTTA...

CDS

Download CDS FASTA

2349 bp · TkA04G192270|TK1151|CDS

ATGAATTTCATATTCATGGCCCAATTACTGCTTGCATTTCTCATCTTTCAGTTTGTCCAAACCAATGTTAATGGAGAATCCATTAACTTGTCATCTCCACTTGTTGCTGGTGCACAATCCAAGAATGCATGGTACTCCGACTCTAAAATGTTTGCATTTGGATTTTACCAATTACAAGGCACCACCGGATACGTGGTTGCAATCTGGTTAGAAAGCTTCGGAGAAAACACGGTTGTGTGGACTGCTTATCGAAACGATCC...

Protein

Download Protein FASTA

782 aa · TkA04G192270|TK1151|PROTEIN

MNFIFMAQLLLAFLIFQFVQTNVNGESINLSSPLVAGAQSKNAWYSDSKMFAFGFYQLQGTTGYVVAIWLESFGENTVVWTAYRNDPPVSKNARLTHTLERELVLSCEDSGVNKTIATNVSSAVMNNTGNFVLYDDKMGVVWQSFDHPTDSLLKGQILFGGNELVSSLSKTNYSSGGFCIIMQMDGNLVMYPLKTGSGLAYWHTNTHKDKGSNNSLYLSDTGLLLINGSNISSTVVKILYSKPKDTAFYRATLGDDGIFR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G192270`
TK1151 ID	TkA04G192270
OH-1004 ID	LXL04_029853
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 95.716 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G192270

Location Chr04:49591368-49595631 (+)

Description Similar to LECRK3: G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q25AG3`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release
`UniProt: A2XQD3`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release
`Os04g0202500`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release
`Os04g0202300`	Involved in resistance against the herbivorous insect brown planthopper (N.lugens, BPH).	No verified direct reference in this release
`Os04g0201900`	Involved in innate immunity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029853 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0051707 response to other organism Biological Process

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030246 carbohydrate binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

dosa:Os04g0201900

dosa:Os04g0202350

dosa:Os04g0202500

osa:9266608

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.855

Rank 1 · TkA04G192270 · TK1151

Endoplasmic reticulum0.082

Rank 2 · TkA04G192270 · TK1151

Cytoplasm0.071

Rank 3 · TkA04G192270 · TK1151

Nucleus0.037

Rank 4 · TkA04G192270 · TK1151

Lysosome / Vacuole0.029

Rank 5 · TkA04G192270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453B_lectin77-157 aa

PF08269dCache_2162-194 aa

PF01453B_lectin181-256 aa

PF00954S_locus_glycop234-308 aa

PF08276PAN_2359-386 aa

PF07714PK_Tyr_Ser-Thr501-706 aa

PF00069Pkinase502-764 aa

PF03109ABC1504-534 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G192270	`PF01453`	B_lectin	77	157	2.1e-17	64.2
TkA04G192270	`PF08269`	dCache_2	162	194	0.23	11.3
TkA04G192270	`PF01453`	B_lectin	181	256	2.1e-17	64.2
TkA04G192270	`PF00954`	S_locus_glycop	234	308	1.7e-07	32.4
TkA04G192270	`PF08276`	PAN_2	359	386	0.063	14.1
TkA04G192270	`PF07714`	PK_Tyr_Ser-Thr	501	706	1.3e-41	143.3
TkA04G192270	`PF00069`	Pkinase	502	764	1.9e-46	159.3
TkA04G192270	`PF03109`	ABC1	504	534	0.003	17.4
TkA04G192270	`PF03109`	ABC1	568	655	0.003	17.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q25AG3`	Oryza sativa subsp. indica	sp\|Q25AG3\|LERK3_ORYSI G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3	39.300%	Swiss-Prot	Medium
`A2XQD3`	Oryza sativa subsp. indica	sp\|A2XQD3\|LERK2_ORYSI G-type lectin S-receptor-like serine/threonine-protein kinase LECRK2	38.800%	Swiss-Prot	Medium
`Q0JEU6`	Oryza sativa subsp. japonica	sp\|Q0JEU6\|LERK3_ORYSJ G-type lectin S-receptor-like serine/threonine-protein kinase LECRK3	39.200%	Swiss-Prot	Medium
`Q7FAZ2`	Oryza sativa subsp. japonica	sp\|Q7FAZ2\|LERK2_ORYSJ G-type lectin S-receptor-like serine/threonine-protein kinase LECRK2	38.900%	Swiss-Prot	Medium
`Q7FAZ3`	Oryza sativa subsp. japonica	sp\|Q7FAZ3\|LERK1_ORYSJ G-type lectin S-receptor-like serine/threonine-protein kinase LECRK1	37.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card