RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G177760
Reference: TK1151 Chr: Chr04 Coordinates: 46011875-46012396 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

522 bp · TkA04G177760|TK1151|cDNA

ATGACGGATGCAAAGTATCAGGAAACGTTAAGAGAAGATGAAATCAAGGAAAAAATCGAATTAGGGATCAGAGAGAGGAACGTCGAAAGAGCTTTCGCCAACAATTTACTCGTTTCCATTGTTGAGGTCATCGGGATCTCAACCGACCAGTCCGTTCTGCGACAAGAATATGAAGACTTCAAAAACGAAATGGAAATCGTCGGGCCGGCAGAAGACGTGGCGGAGGTATTACAAATCGAACAGATCGTGGCGTTGTTAGG...

CDS

Download CDS FASTA

522 bp · TkA04G177760|TK1151|CDS

ATGACGGATGCAAAGTATCAGGAAACGTTAAGAGAAGATGAAATCAAGGAAAAAATCGAATTAGGGATCAGAGAGAGGAACGTCGAAAGAGCTTTCGCCAACAATTTACTCGTTTCCATTGTTGAGGTCATCGGGATCTCAACCGACCAGTCCGTTCTGCGACAAGAATATGAAGACTTCAAAAACGAAATGGAAATCGTCGGGCCGGCAGAAGACGTGGCGGAGGTATTACAAATCGAACAGATCGTGGCGTTGTTAGG...

Protein

Download Protein FASTA

173 aa · TkA04G177760|TK1151|PROTEIN

MTDAKYQETLREDEIKEKIELGIRERNVERAFANNLLVSIVEVIGISTDQSVLRQEYEDFKNEMEIVGPAEDVAEVLQIEQIVALLGKADMIATLEEREKKYFSKRNSLGRQPLESLQSFYCPITGDVMEDPVETPSGHSFERCAIEKWLAEGNNSCPITKKPLKASALRTSD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G177760
TK1151 IDTkA04G177760
OH-1004 IDLXL04_023524
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)98.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G177760
LocationChr04:46011875-46012396 (-)
DescriptionSimilar to LIN: Putative E3 ubiquitin-protein ligase LIN-2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g21350 Functions as an E3 ubiquitin ligase (By similarity).
A cryptic modifier causing transient self-incompatibility in Arabidopsis thaliana.2007 · DOI: 10.1016/j.cub.2007.03.022
At3g07360 Functions as an E3 ubiquitin ligase (By similarity).
Interactions between the S-domain receptor kinases and AtPUB-ARM E3 ubiquitin ligases suggest a conserved signaling pathway in Arabidopsis.2008 · DOI: 10.1104/pp.108.123380

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: A2ZLU6 Defense related protein that negatively regulates programmed cell death. No verified direct reference in this release
Os12g0570000 E3 ubiquitin-protein ligase that negatively regulates programmed cell death and disease resistance.
Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U-box/armadillo repeat protein endowed with E3 ubiquitin ligase activity.2004 · DOI: 10.1105/tpc.104.025171
SPIN1, a K homology domain protein negatively regulated and ubiquitinated by the E3 ubiquitin ligase SPL11, is involved in flowering time control in rice.2008 · DOI: 10.1105/tpc.108.058610
Os06g0102700 Possesses E3 ubiquitin-protein ligase in vitro. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_023524 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0007166 cell surface receptor signaling pathway Biological Process
GO:0009877 nodulation Biological Process
GO:0009908 flower development Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0031348 negative regulation of defense response Biological Process
GO:0043069 negative regulation of programmed cell death Biological Process
GO:0048586 regulation of long-day photoperiodism, flowering Biological Process
GO:2000028 regulation of photoperiodism, flowering Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
KEGG gene cross-reference
dosa:Os12g0570000
mtr:11418360
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.644
Rank 1 · TkA04G177760 · TK1151
Cytoplasm0.409
Rank 2 · TkA04G177760 · TK1151
Cell membrane0.051
Rank 3 · TkA04G177760 · TK1151
Mitochondrion0.036
Rank 4 · TkA04G177760 · TK1151
Endoplasmic reticulum0.029
Rank 5 · TkA04G177760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04564U-box9-20 aa
PF11789zf-Nse117-159 aa
PF04564U-box120-169 aa
PF13923zf-C3HC4_2121-159 aa
PF13445zf-RING_UBOX122-158 aa
PF00097zf-C3HC4122-158 aa
PF15227zf-C3HC4_4122-158 aa
PF13639zf-RING_2129-159 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G177760PF04564U-box9203.3e-1350.3
TkA04G177760PF11789zf-Nse1171594.6e-0730.3
TkA04G177760PF04564U-box1201693.3e-1350.3
TkA04G177760PF13923zf-C3HC4_21211590.0001222.5
TkA04G177760PF13445zf-RING_UBOX1221581.5e-0525.6
TkA04G177760PF00097zf-C3HC41221580.05814.0
TkA04G177760PF15227zf-C3HC4_41221580.1712.8
TkA04G177760PF13639zf-RING_21291590.2212.5
TkA04G177760PF12678zf-rbx11361590.004118.0
TkA04G177760PF11789zf-Nse1541654.6e-0730.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O81902Arabidopsis thalianasp|O81902|PUB8_ARATH U-box domain-containing protein 853.300%Swiss-ProtLow
Q9SRT0Arabidopsis thalianasp|Q9SRT0|PUB9_ARATH U-box domain-containing protein 934.900%Swiss-ProtLow
A2ZLU6Oryza sativa subsp. indicasp|A2ZLU6|SL11_ORYSI Protein spotted leaf 1141.400%Swiss-ProtLow
Q0IMG9Oryza sativa subsp. japonicasp|Q0IMG9|SL11_ORYSJ E3 ubiquitin-protein ligase SPL1141.400%Swiss-ProtLow
Q5VRH9Oryza sativa subsp. japonicasp|Q5VRH9|PUB12_ORYSJ U-box domain-containing protein 1232.600%Swiss-ProtMedium

JBrowse

View in Genome Browser