TkA04G175590 | RubberDandelionOmics

Gene overview

TkA04G175590

Reference: TK1151 Chr: Chr04 Coordinates: 45464567-45468648 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2423 bp · TkA04G175590|TK1151|cDNA

GAAAGACGGGGGGATGTTCAGTGTGGACTTTGGGCGCTTGAAAGTTCCAGTGGAAGAAGCTAGGGCACGCTTTCTCCCTCTGCATCGTCGTCAAATTTTTATGTGATAAGAATTGTGCTTAGATAGAGAAAATGCCGTTCATATCGCAAACGGAGAGACAATCCGATTACAATCTCATACCTTCAAGCTGCCCAATCGTTATCGACAATGGCGCCTCTTATTTTAGAATGGGATGGGCAGGAGAGAGTGAGCCTCGAATC...

CDS

Download CDS FASTA

1368 bp · TkA04G175590|TK1151|CDS

ATGCTGGCAACTTCCATGGACACCAACACCAGTGGAAGAGCCACCATCCGAAGAGGAGATTGCAAGGAAAGCAGCTTTAAGAGAAAAACACGGTCAAAGGTTACGGGAAATGGCCGAGGCAAAAAGATGTTCGAAAATAAACGAACTAGAAAACGAATTAAAGGGTTGGAATTTCTTATTCAACAACTTAGACACGTAAATGGAAACGACATCCCGTCTTTTTTATCCGAAACCGGTTACGTATCCAAGCAAGAAATCGA...

Protein

Download Protein FASTA

455 aa · TkA04G175590|TK1151|PROTEIN

MLATSMDTNTSGRATIRRGDCKESSFKRKTRSKVTGNGRGKKMFENKRTRKRIKGLEFLIQQLRHVNGNDIPSFLSETGYVSKQEIESAIVKVTQSLRKAKGEQDEIEEKQDPSGTEKYTLIDIPDNLLTPEQIKEKKRQLFLKTTSEGRQRAKQKRFEQELERERRNKEDEQRRLENPEVYMEQLRVKYKELSEKVDQRKKQKTNANNTTETNNGVGRGERLNAAQKERMRLLTTAAFDRGKGEDTFGIKDEDWQLYKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G175590`
TK1151 ID	TkA04G175590
OH-1004 ID	LXL04_035044
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 88.571 / OH-1004 56.128 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G175590

Location Chr04:45464567-45468648 (-)

Description Similar to ARP5: Actin-related protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12380`	Probable subunit of a chromatin-remodeling complex.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2WKK5`	Actin-related protein 5.	No verified direct reference in this release
`Os01g0144340`	Actin-related protein 5.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035044 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006974 DNA damage response Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0030029 actin filament-based process Biological Process

GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process

GO:0080036 regulation of cytokinin-activated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G12380

ddi:DDB_G0291728

spo:2541031

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.937

Rank 1 · TkA04G175590 · TK1151

Cytoplasm0.157

Rank 2 · TkA04G175590 · TK1151

Mitochondrion0.025

Rank 3 · TkA04G175590 · TK1151

Cell membrane0.016

Rank 4 · TkA04G175590 · TK1151

Endoplasmic reticulum0.007

Rank 5 · TkA04G175590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02601Exonuc_VII_L144-230 aa

PF22251PFF1_TM145-241 aa

PF01913FTR179-224 aa

PF00022Actin316-446 aa

PF01913FTR343-390 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G175590	`PF02601`	Exonuc_VII_L	144	230	2.5	8.2
TkA04G175590	`PF22251`	PFF1_TM	145	241	6.1	7.0
TkA04G175590	`PF01913`	FTR	179	224	0.098	13.3
TkA04G175590	`PF00022`	Actin	316	446	4e-21	75.8
TkA04G175590	`PF01913`	FTR	343	390	0.098	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940Z2`	Arabidopsis thaliana	sp\|Q940Z2\|ARP5_ARATH Actin-related protein 5	60.600%	Swiss-Prot	High
`A2WKK5`	Oryza sativa subsp. indica	sp\|A2WKK5\|ARP5_ORYSI Actin-related protein 5	49.600%	Swiss-Prot	Medium
`A2ZP58`	Oryza sativa subsp. japonica	sp\|A2ZP58\|ARP5_ORYSJ Actin-related protein 5	49.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card