TkA04G171850 | RubberDandelionOmics

Gene overview

TkA04G171850

Reference: TK1151 Chr: Chr04 Coordinates: 44466811-44469250 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1647 bp · TkA04G171850|TK1151|cDNA

TTCAAATAACCGACCTTTATTTCCTTTTCACCTACGTCATCAAAGTACATTCCTTTTAAGGAGATGAAATGGGCGTATTGCTTGGTGCTCTCCAACGCCGATTAGGAGTTATCGTCAAGAACCAATCATACGCCATTACCAAGTACTAAAACTGGATACGCTGCAACAATTAACTCCGAAGTTGAAGATTTGCATCAGCCAAGCTTCGTGATTCGTCAAAGCGGGGTCATCATCTGCTAGGGTTTTGTTATTTTCCAGAC...

CDS

Download CDS FASTA

999 bp · TkA04G171850|TK1151|CDS

ATGCAAACGGAAGCGACGGTGGGGGTGGTGGAAGGCGGTGGACCCGCTCGTAAATTGGTGACGCATCACCAGAGGCCGGTGCAACAGCAACAATCCCAGGTAGGTACGGTTTCGCAACTCATAGCCGGTGGTGTCGCCGGAGCCGTTAGCAAGACCTGCACTGCCCCTCTTGCTCGCCTCACTATACTTCTCCAGGTACAGGGCATGCATTCCGATGCTTCCACCTTAAGAAAAGCAAGTATATGGCGTGAAGCTTCGCG...

Protein

Download Protein FASTA

332 aa · TkA04G171850|TK1151|PROTEIN

MQTEATVGVVEGGGPARKLVTHHQRPVQQQQSQVGTVSQLIAGGVAGAVSKTCTAPLARLTILLQVQGMHSDASTLRKASIWREASRIVNEEGFRAFWKGNLVTIAHRLPYSSISFYAFERYKNLLQMIMGVESHGTNISADLCIRLAGGGLAGITAASVTYPLDLVRTRLSAQRNVIYYRGIWHALRTISREEGVFGLYKGLGACLLGVGPNLAISFSVYDTARCYWQMQRPEDSTVLVSLACGSLSGIASSTVTFPLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G171850`
TK1151 ID	TkA04G171850
OH-1004 ID	LXL04_018560
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	68.300
Protein coverage (%)	TK1151 90.361 / OH-1004 83.102 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G171850

Location Chr04:44466811-44469250 (+)

Description Similar to mcfB: Mitochondrial substrate carrier family protein B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01100`	Mitochondrial adenylate carrier that catalyzes specifically the transport of ATP, ADP and AMP by a counter-exchange mechanism across the inner mitochondrial membrane.	Identification and characterization of ADNT1, a novel mitochondrial adenine nucleotide transporter from Arabidopsis.2008 · DOI: 10.1104/pp.108.130310
`At4g32400`	Probable mitochondrial adenylate carrier that catalyzes the transport of ATP, ADP and AMP, but not ADP-glucose.	Isolation and characterization of shs1, a sugar-hypersensitive and ABA-insensitive mutant with multiple stress responses.2007 · DOI: 10.1007/s11103-007-9219-y

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018560 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006839 mitochondrial transport Biological Process

GO:0015866 ADP transport Biological Process

GO:0015867 ATP transport Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0051503 adenine nucleotide transport Biological Process

GO:0071277 cellular response to calcium ion Biological Process

GO:1990544 mitochondrial ATP transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0000295 adenine nucleotide transmembrane transporter activity Molecular Function

GO:0005347 ATP transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ddi:DDB_G0285599

hsa:29957

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.911

Rank 1 · TkA04G171850 · TK1151

Cytoplasm0.042

Rank 2 · TkA04G171850 · TK1151

Nucleus0.031

Rank 3 · TkA04G171850 · TK1151

Cell membrane0.023

Rank 4 · TkA04G171850 · TK1151

Peroxisome0.019

Rank 5 · TkA04G171850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00153Mito_carr34-127 aa

PF18405SLC25_like38-60 aa

PF18405SLC25_like137-166 aa

PF00153Mito_carr146-228 aa

PF00153Mito_carr236-328 aa

PF18405SLC25_like251-289 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G171850	`PF00153`	Mito_carr	34	127	5.4e-74	244.7
TkA04G171850	`PF18405`	SLC25_like	38	60	0.0099	15.7
TkA04G171850	`PF18405`	SLC25_like	137	166	0.0099	15.7
TkA04G171850	`PF00153`	Mito_carr	146	228	5.4e-74	244.7
TkA04G171850	`PF00153`	Mito_carr	236	328	5.4e-74	244.7
TkA04G171850	`PF18405`	SLC25_like	251	289	0.0099	15.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04619`	Arabidopsis thaliana	sp\|O04619\|ADNT1_ARATH Mitochondrial adenine nucleotide transporter ADNT1	37.300%	Swiss-Prot	Medium
`Q9SUV1`	Arabidopsis thaliana	sp\|Q9SUV1\|BRT1_ARATH Adenine nucleotide transporter BT1, chloroplastic/mitochondrial	40.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card