TkA04G170670 | RubberDandelionOmics

Gene overview

TkA04G170670

Reference: TK1151 Chr: Chr04 Coordinates: 44122172-44124033 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1384 bp · TkA04G170670|TK1151|cDNA

AAAAACTAAAAAACAAATAGAGTTTTTCCGGATTGTGTATAAAATCTGAACCCAAAAAGAAACTTAAATTCTTCTAGGGTTTTACATAGTTCTTCCCCCCACCTCTCAGACTTTAGGTTAAAGAGACCGCCGCCGTCCGCCTTGGCTTAGCAAAGCTCGGTCTTGGTCCTTAGTTTTTGTAACCAGAATCTCTTCCTTTCATATTTAGGGTTTTTTGGTTCAGTTTTTCACTAAAATGGGTAAGATTTCCAAAGCTGATA...

CDS

Download CDS FASTA

969 bp · TkA04G170670|TK1151|CDS

ATGGGTAAGATTTCCAAAGCTGATAAGAAGATTGCCTACGATCAGAAGCTTTGCCAGCTTCTCGATGATTACACTCAGGTCCTCATCTCTGCGGCTGATAATGTCGGCTCTAATCAACTTCAGAATATTCGTCATGGTCTTCGAGGCGATTCAGTAATCCTTATGGGCAAAAACACTATGATGAAGCGTTCTATCAGGATGCATTCAGAGAAGACCGGCAACACAGCATACTTGAATCTGATCCCACTCCTTGTTGGGAA...

Protein

Download Protein FASTA

322 aa · TkA04G170670|TK1151|PROTEIN

MGKISKADKKIAYDQKLCQLLDDYTQVLISAADNVGSNQLQNIRHGLRGDSVILMGKNTMMKRSIRMHSEKTGNTAYLNLIPLLVGNVGLIFTKGDLKEVSEEVAKYKVGAPARVGLVAPVDVVVPPGNTGLDPSQTSFFQVLNIPTKINKGTVEIITPVELIKKGDKVGSSEAALLAKLGIRPFSYGLVVLTVYDNGSVFSPEVLNMTEDDLVSKFAIGVSMVTSLALAIHYPTIAAAPHMLINAYKNALAIAVETGYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G170670`
TK1151 ID	TkA04G170670
OH-1004 ID	LXL04_035081
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 71.938 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G170670

Location Chr04:44122172-44124033 (-)

Description Similar to 60S acidic ribosomal protein P0

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09200`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release
`At3g11250`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release
`At2g40010`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0130500`	Ribosomal protein P0 is the functional equivalent of E.coli protein L10.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035081 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

KEGG gene cross-reference

ath:AT2G40010

ath:AT3G09200

ath:AT3G11250

dosa:Os08g0130500

gmx:547816

osa:4344590

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.853

Rank 1 · TkA04G170670 · TK1151

Nucleus0.229

Rank 2 · TkA04G170670 · TK1151

Endoplasmic reticulum0.083

Rank 3 · TkA04G170670 · TK1151

Mitochondrion0.053

Rank 4 · TkA04G170670 · TK1151

Cell membrane0.049

Rank 5 · TkA04G170670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00466Ribosomal_L107-107 aa

PF00428Ribosomal_60s94-110 aa

PF17777RL10P_insert113-182 aa

PF00428Ribosomal_60s233-320 aa

PF00466Ribosomal_L10265-275 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G170670	`PF00466`	Ribosomal_L10	7	107	7.6e-17	62.0
TkA04G170670	`PF00428`	Ribosomal_60s	94	110	2.8e-21	76.5
TkA04G170670	`PF17777`	RL10P_insert	113	182	6.8e-22	77.9
TkA04G170670	`PF00428`	Ribosomal_60s	233	320	2.8e-21	76.5
TkA04G170670	`PF00466`	Ribosomal_L10	265	275	7.6e-17	62.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42112`	Arabidopsis thaliana	sp\|Q42112\|RLA02_ARATH Large ribosomal subunit protein uL10y	85.200%	Swiss-Prot	High
`P57691`	Arabidopsis thaliana	sp\|P57691\|RLA03_ARATH Large ribosomal subunit protein uL10x	84.800%	Swiss-Prot	High
`O04204`	Arabidopsis thaliana	sp\|O04204\|RLA01_ARATH Large ribosomal subunit protein uL10z	81.900%	Swiss-Prot	High
`P41095`	Oryza sativa subsp. japonica	sp\|P41095\|RLA0_ORYSJ Large ribosomal subunit protein uL10	81.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card