TkA04G152650 | RubberDandelionOmics

Gene overview

TkA04G152650

Reference: TK1151 Chr: Chr04 Coordinates: 39445652-39448365 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1203 bp · TkA04G152650|TK1151|cDNA

ATGTTCCTCTCTCAGCACAAATATGCAACCGAAATTCTCGAACGCGCTCATATACTTAATTGCAAACCCGCTCGCACTCCAGCTGACACCTCGGCAAAATTTGACGGTACCGGTCCGCCGGTTTCTGACCCCACTCTTTATCGCAGCCTTGCAGGTGCTCTCCAGTACCTCACGTTTACCCGCCCAGACATCGCATATGCTGTCCAGCAAATCTGTCTATATATGCACGACCCCAGAGAGCCACACTTTCAGGCCCTCAA...

CDS

Download CDS FASTA

1203 bp · TkA04G152650|TK1151|CDS

ATGTTCCTCTCTCAGCACAAATATGCAACCGAAATTCTCGAACGCGCTCATATACTTAATTGCAAACCCGCTCGCACTCCAGCTGACACCTCGGCAAAATTTGACGGTACCGGTCCGCCGGTTTCTGACCCCACTCTTTATCGCAGCCTTGCAGGTGCTCTCCAGTACCTCACGTTTACCCGCCCAGACATCGCATATGCTGTCCAGCAAATCTGTCTATATATGCACGACCCCAGAGAGCCACACTTTCAGGCCCTCAA...

Protein

Download Protein FASTA

400 aa · TkA04G152650|TK1151|PROTEIN

MFLSQHKYATEILERAHILNCKPARTPADTSAKFDGTGPPVSDPTLYRSLAGALQYLTFTRPDIAYAVQQICLYMHDPREPHFQALKRILRYIRGTMDHGLQLYVSPSRSLIAYTDADWAGCPSTRRSTSSYCVFLGQNLLSWSSKRQTTISRSSAEAEYRGVANAVAETCWLRNLLRELLYPPLTATTPVNNYKMSDVEDAAATPVRVKEVGSTTVACPMLNSTNYTVWSLRMKVVLRIHKAWSVIDLGTEKNDDKDYL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G152650`
TK1151 ID	TkA04G152650
OH-1004 ID	LXL04_015296
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.700
Protein coverage (%)	TK1151 51.500 / OH-1004 12.103 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G152650

Location Chr04:39445652-39448365 (-)

Description Similar to Retrovirus-related Pol polyprotein from transposon TNT 1-94

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: P92519`	Uncharacterized mitochondrial protein AtMg00810.	No verified direct reference in this release
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015296 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009768 photosynthesis, light harvesting in photosystem I Biological Process

GO:0015074 DNA integration Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009522 photosystem I Cellular Component

GO:0009523 photosystem II Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G76570

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.444

Rank 1 · TkA04G152650 · TK1151

Nucleus0.343

Rank 2 · TkA04G152650 · TK1151

Mitochondrion0.086

Rank 3 · TkA04G152650 · TK1151

Peroxisome0.058

Rank 4 · TkA04G152650 · TK1151

Plastid0.051

Rank 5 · TkA04G152650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14244Retrotran_gag_3220-248 aa

PF13961DUF4219222-247 aa

PF14223Retrotran_gag_2252-395 aa

PF13961DUF4219284-290 aa

PF01049CADH_Y-type_LIR312-338 aa

PF06787HcgF340-391 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G152650	`PF14244`	Retrotran_gag_3	220	248	0.058	13.9
TkA04G152650	`PF13961`	DUF4219	222	247	1.3e-07	31.9
TkA04G152650	`PF14223`	Retrotran_gag_2	252	395	1.4e-16	61.4
TkA04G152650	`PF13961`	DUF4219	284	290	1.3e-07	31.9
TkA04G152650	`PF01049`	CADH_Y-type_LIR	312	338	0.086	13.6
TkA04G152650	`PF06787`	HcgF	340	391	0.095	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P92519`	Arabidopsis thaliana	sp\|P92519\|M810_ARATH Uncharacterized mitochondrial protein AtMg00810	51.200%	Swiss-Prot	Low
`Q9ZT94`	Arabidopsis thaliana	sp\|Q9ZT94\|POLR2_ARATH Retrovirus-related Pol polyprotein from transposon RE2	49.700%	Swiss-Prot	Low
`Q94HW2`	Arabidopsis thaliana	sp\|Q94HW2\|POLR1_ARATH Retrovirus-related Pol polyprotein from transposon RE1	49.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card