TkA04G151120 | RubberDandelionOmics

Gene overview

TkA04G151120

Reference: TK1151 Chr: Chr04 Coordinates: 39066283-39070411 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2940 bp · TkA04G151120|TK1151|cDNA

GAGAGCCCGAAAGTCCTAGGATCCAGATAGGCAGATAGGATATCCTCTCTCTACGATAAGCCATTCAGATTTTGGAGTGTAAAGAACTGTGGGTCTATCATCCTTCTCCCCCATCACTGTAAAAACAAGAAACCCTAGATACTCACAAAACCCTATAATTTGACTGACCGGAACTAAACATCTGCGATTCCTTCGTGTTTAGGTAAACTAACACCATGAGTGTTTTGATCACAACAAGGTCTCCGAGCTCTTACCAGCTC...

CDS

Download CDS FASTA

2478 bp · TkA04G151120|TK1151|CDS

ATGAGTGTTTTGATCACAACAAGGTCTCCGAGCTCTTACCAGCTCCGATTAGCCGCTTCCAATTGCAGGAAGTATCCCTCATCTTCTATCTATATACGGATGCATGTTCACAAGCTAGACCATCCAATTCGTTGTTCTTTGAATTCCGATGATTATTTGTCTCAACGACGAACGAGTTCGAAATTTTCTGTTAATGCCTTTTCTGGATGGTCCGGTGACGATAATGGTAGCGACGTGTTGCAAGAATCGCCGCCGAAAAA...

Protein

Download Protein FASTA

825 aa · TkA04G151120|TK1151|PROTEIN

MSVLITTRSPSSYQLRLAASNCRKYPSSSIYIRMHVHKLDHPIRCSLNSDDYLSQRRTSSKFSVNAFSGWSGDDNGSDVLQESPPKKNSYGGIVGAAVAGVVVVAGLSFATLSISKRMSGTKKTMETLTTHQEESLTSADQNDNLEAEVPKSENGDSHLHETQNETATEDSIPQEELPTPEIQTEAIETPGIPNSDVDDDLVDSSTIQSLDDTEKLESDDNLKEDVPDVNSVIPDSDLQETELVANEVDIGSKIENFDNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G151120`
TK1151 ID	TkA04G151120
OH-1004 ID	LXL04_035232
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G151120`
Location	Chr04:39066283-39070411 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035232` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.978

Rank 1 · TkA04G151120 · TK1151

Cytoplasm0.033

Rank 2 · TkA04G151120 · TK1151

Nucleus0.032

Rank 3 · TkA04G151120 · TK1151

Peroxisome0.025

Rank 4 · TkA04G151120 · TK1151

Mitochondrion0.023

Rank 5 · TkA04G151120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06103DUF94896-138 aa

PF11863E217_gp31_N105-165 aa

PF03549Tir_receptor_M163-208 aa

PF03549Tir_receptor_M311-331 aa

PF00395SLH327-354 aa

PF00395SLH386-409 aa

PF00395SLH495-515 aa

PF06103DUF948542-563 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G151120	`PF06103`	DUF948	96	138	0.32	11.9
TkA04G151120	`PF11863`	E217_gp31_N	105	165	0.0054	17.2
TkA04G151120	`PF03549`	Tir_receptor_M	163	208	0.58	11.3
TkA04G151120	`PF03549`	Tir_receptor_M	311	331	0.58	11.3
TkA04G151120	`PF00395`	SLH	327	354	5.4e-05	23.8
TkA04G151120	`PF00395`	SLH	386	409	5.4e-05	23.8
TkA04G151120	`PF00395`	SLH	495	515	5.4e-05	23.8
TkA04G151120	`PF06103`	DUF948	542	563	0.32	11.9
TkA04G151120	`PF06103`	DUF948	576	593	0.32	11.9
TkA04G151120	`PF11863`	E217_gp31_N	670	759	0.0054	17.2
TkA04G151120	`PF06103`	DUF948	732	768	0.32	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card