TkA04G131250 | RubberDandelionOmics

Gene overview

TkA04G131250

Reference: TK1151 Chr: Chr04 Coordinates: 34218278-34223259 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4822 bp · TkA04G131250|TK1151|cDNA

TTTTGCCCTAGGGTCTGGACCTTTTTGGAGGGAGAAGCAACAAAAAATTGGGATCTTTTTAGCCACGTTTCATTCATCGACGGTCTGTGTGGTCATCATCTACAAAACCTTCTCCCAATCCGCCAAAAGTTAATGTCTTCTCTCGGCCATCACATATACACACATACTCGATGACGAATTAGTTCTCCATTTTTGTAAAATCTTTGTAAAACCCGCAGGAGGATGTCATTCACGTCTGGAATCTTGGCTTTTGCTGCACC...

CDS

Download CDS FASTA

4359 bp · TkA04G131250|TK1151|CDS

ATGTCATTCACGTCTGGAATCTTGGCTTTTGCTGCACCTTCGCCAACACTAAACGCCATTAACGATACATCGAAGGTACGCAAAACCATTACTTCTCATGTTTCCTGCTCAACCTCTTCTTCTGCCGTTACAACCATCGAACAGCAAGAACCGTCCAAGAAATTTAGCTACAGCAGAGCATCTCCATCAGTCAGATGGCCTAACCGTAAAGAACCCGCCGATAATCATAACTCAGACAAAACGCAGTTCCCAATTTCACC...

Protein

Download Protein FASTA

1452 aa · TkA04G131250|TK1151|PROTEIN

MSFTSGILAFAAPSPTLNAINDTSKVRKTITSHVSCSTSSSAVTTIEQQEPSKKFSYSRASPSVRWPNRKEPADNHNSDKTQFPISPTNPKIDVFVHEPLTEVEGETAPLEENNETLEYSGRNSRGVAKKMTKLALKRAKDWRQRVQFLTDRILGLKSHEFVADVLDDRQVQMTPTDFCFLVKGIGKSNWQRALEVYEWLNLRKWYSPNARMLATILGVLGKANQEALAMEIFHRSEEAIDSSVQVYNAMMGVYARNGRF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G131250`
TK1151 ID	TkA04G131250
OH-1004 ID	LXL04_035431
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G131250

Location Chr04:34218278-34223259 (+)

Description Similar to EMB1270: Pentatricopeptide repeat-containing protein At3g18110, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18110`	May play a role in embryogenesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035431 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0031425 chloroplast RNA processing Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G18110

ath:AT5G02860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.588

Rank 1 · TkA04G131250 · TK1151

Mitochondrion0.262

Rank 2 · TkA04G131250 · TK1151

Nucleus0.078

Rank 3 · TkA04G131250 · TK1151

Cytoplasm0.027

Rank 4 · TkA04G131250 · TK1151

Cell membrane0.012

Rank 5 · TkA04G131250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23276TPR_24162-200 aa

PF13432TPR_16188-213 aa

PF12921ATP13207-234 aa

PF13812PPR_3212-255 aa

PF23276TPR_24214-342 aa

PF31234TPR_Psidin_N214-265 aa

PF01535PPR216-235 aa

PF17177PPR_long222-365 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G131250	`PF23276`	TPR_24	162	200	1.1e-48	165.2
TkA04G131250	`PF13432`	TPR_16	188	213	0.00013	23.1
TkA04G131250	`PF12921`	ATP13	207	234	4.4e-08	33.7
TkA04G131250	`PF13812`	PPR_3	212	255	2.3e-86	284.5
TkA04G131250	`PF23276`	TPR_24	214	342	1.1e-48	165.2
TkA04G131250	`PF31234`	TPR_Psidin_N	214	265	0.026	14.7
TkA04G131250	`PF01535`	PPR	216	235	1.4e-103	332.8
TkA04G131250	`PF17177`	PPR_long	222	365	2.4e-47	161.8
TkA04G131250	`PF29070`	MSC6_N	222	288	5.6e-47	161.4
TkA04G131250	`PF18768`	RNPP_C	226	263	0.039	14.2
TkA04G131250	`PF14559`	TPR_19	229	273	3.5e-05	24.7
TkA04G131250	`PF25058`	ARM_TT21	232	309	3.7e-07	30.9
TkA04G131250	`PF12000`	Glyco_trans_4_3	233	280	0.13	12.7
TkA04G131250	`PF13812`	PPR_3	240	288	2.3e-86	284.5
TkA04G131250	`PF13041`	PPR_2	244	288	2.3e-123	402.9
TkA04G131250	`PF12854`	PPR_1	244	271	7.3e-82	269.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5G1S8`	Arabidopsis thaliana	sp\|Q5G1S8\|PP241_ARATH Pentatricopeptide repeat-containing protein At3g18110, chloroplastic	59.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card